CR01679

CRIMIC CR01679

Gene Gyg

CG44244

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GGAAGACATAAGATCATTTGGGG

Amplicon 5' Amplicon 3'
GGTGACGCTGACGACAAATGACACGTACTCACTGGGTGCCTTGGTCTTGGCCCACTCACTGAAAAGGGCCAAGACCGCCCACCAGCTGGCCGTTCTGGTCACGCCCAATGTCTCGCAGGCGATGCGCGACCGACTGAAGGAGGTCTACAATGTGGTGCAGGAGGTCAATGTGCTCGACTCACAGGATGCCGCCAATCTGGCGCTCCTCTCGCGACCCGAACTAGGCGTGACCTTCACAAAACTCCACTGCTGGCGCCTCGTTCAGTTTGAGAAGTGCGTCTTCCTGGATGCGGACACACTGGTAAGATATGAAGTATTCCAAGGGCACAACATGTAACTTGTGAGCTAACAAAGACTTAAATAACTACTTTCAATTTGATTTCGTAGGTCTTGCAAAACTGCGATGAGCTCTTCGAGCGCGAGGAACTGTCGGCTGCTCCGGATGTCAGCTGGCCGGATTGCTTCAATTCCGGCGTGTTTGTGTTCAAACCTAGCGTGGACACCTTTGCCCAGATCACAGAGTTTGCCGTGAAGAATGGCAGCTTCGATGGCGGTGACCAGGGTCTGCTGAATCAGTTCTTTGCCGACTGGTCGACGGCGGACATTAAGAAGCATTTGCCATTTGTGTACAATGTGACGGCTTATGCCTCGTACTGTTATCTGCCCGCCTTCAAACAGTAAGTTCGCTATCTCTGTGGAATGGAAAAGCAGTTTGTAATGGCATTTGTTTGCTTGCAGGTTCAGAGATAAGATTAAGATTTTGCATTTTGCCGGCAAGCTGAAGCCCTGGCTGATTCAGTTCAACTCGGAAACAAAGGTGGCCAGCGTTTCGTCGGAGTATGCTCATGCCCAGGATTTGATTCAGCTGTGGTGGAACATCTTTTGCGAAAATGTCATCCAGTCCCTGTCCACCGAAATGGTAAGTGCTATTTATACAATGGATAACGCACATTTTGGAAATTTCCAGCGTTACTTGGTGC TCCCTTGTTTTTGAACGCCAGACTGAAGCTAACCCTTTGATTTTTACTGTCTAACCCAATGTATTTGCTCCAAATCTCAAAAACAAAAAACCCTGCTTCGTTTTCTAACACGCTAATCGCAAGCAAACGCCAGGAAATGTTGCTAGTGATCGACCCGCGGGAGAAATGGCCCAAGGGTCCACTACTTTAGAGGTAAGCAGATCTTCAATTGCCGAATCGCACATATCGCACCAGATCTGTAGATACCTTGAGCACAGCCCTGTGTAAATATCTTAATTATAACTTAAATATTTATTTATTTATTTAGCTAACGATTCAGTCATCTTTCTGTGCGCCAAGTAAATAACCCAAGCAAACAAACTCAATTTCGATCTATTTGCCATTTGTTTTTTGCCGATAGCTGGCCTCGATATCGTTTCATTTCCCGCCTCTTTTCTATCAACTCGGTTTGAATATACTTTGTTTTCGTTTTATTTATTTTTATTTTTTTGTATTGGTTTGCAATTTTCTGTTGATTTTTTCTCGATTAGCAGCCACGCCCCAGAGTAACCCATTTTCCTTTTTTTTGTATATTTTCTTTCACTTTTTTGGCACCATAGGCAGACCAATTCTCAATTTATTTCTTCTGTATTTTTTCTGTAATATTTGTGCAACTGTGTGTGTCTCTCGTGTGTGTGTGTGTGTGTGAGTGCTCGTCTTAGTGTTCACTTTCTTTCTGTTTTCTTTTCCTTTCTAATTTGCATCGATTTGGCAAAGAGCCAGGAAAATGTTTCGGTTTACGCCATCGATAGATGGAAATGATTCAAATCAAGATGGTCGGTTGCGGGTGATGCCAAAAAAAAAACTCAACTGAATCATTAGATATATCCCATAACACAAACAAACACACACACACACACACTAGCACGCATTCG


Search Again