CR01674

CRIMIC CR01674

Gene CG32532

CG32532

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGGACACAGGACACAGGAGTCGG

Amplicon 5' Amplicon 3'
TGTCATGGCCTTGCTAATAGTACTAGTTTTTTTTTAATATCTAACACTAGTAATGAACTTAAAAAAGTTGCCCCAAACATTTGAAAAGATGCCTGTGACTTTGATTGGTAATAAATGAATATTTGTAAGATATTTATTTTCTCTTCAAGTGAAATCTTCTAAAGATTTCATTAGTTTGGTAAATGCAATAAGTATTAGGCATTAAAAGGTTATGCTAATTATATTTTAAGCGCTTTTAAAGAGGAAGCCTCTTTCCAGCTATAATTGAAAACTTTAAAGTTGAGGCATCAATCGTCACTTATATTTGTATTCAAATGTATCAAATTTTTTCTACTAAAAAATAGTTGCCATAATCCATTGTCATAATGCAGAAAGTAAAAGTTTGTTAAATAGAAAATGGATATCGGAAATGTGATCTTCTTTCTTCTCTTAAATACTCCCTATATAAATTTAAGTGACTAATTGCGGGAAAGTTTATCCTTTATCTTCAACTCCATTACTCCCAAAATAATAGAATAGAATAATGACACCACCCACCGTGAAAATATTTAATATTGTGCAATTAGAAAATCCTTATTGCCATTTAAACCTAATTGGGAAATGAGCTTCTAGATCAACAGGACACTAAATACGTCATAATATTTGGCGGCAAAAAGTTTTGACAAAATGATTATGCAGATGCGCTTCGTCACTACGTGAACTGCCGTGCACAGTGATGTAAGCGACTTCTTTGGCTAATGATGATGGTTAATTAAGTAGCCTGTAGCAATTTCCAAACCATCATCATCGTTCAATAAACCAAACATACATTGATTCTTGGGCGGAGATAATCGCGTCCTTACTCTCAAATATATATGTACATGTGGATATCCTGACAATTCACTGGCTTTTATGTGACTTAAGTGTGATGTGTTCAATGGGAAATCACTTGGATTAGAGGCTGACCAGCTGTGCCGCAGACTAATCCATGCCACGAGTGGTGGGGCGACCGGAGCAGGACACAGAGGACACAGGACACAGG CGGTACTGGCTGGCGATAAGCCAGGAACAAAGAAGCGAGGACAAGCCGGTAATAGGAAGCTGCAAACGAGCATCAACAAACAAGCGGATGACAAAGGACACGGGTCAAAGGACAAAGGACTCAGTGGCCAAGGGGGGGGGGTGTGGAAGTGAAAGGGGTGCTGGTGCTGGTGCCAAAGGATAATTTCCTGCTAATGGGCAATGGCTAATGGCTAATGGCCATTGTGGCCAGATTAGGAGCCCAGATGCGATCGGGCCACACTCACCCGAGATCGTGTGATCGGAGAGGCGCGACGGCGGCGTGTGGGCCGGCGTATGGTGGTGCGAGGACGAGTCCATGCCGGGCGTGGGCAGGCCGGAGTAGAGGGCGCTGAAATCCTCCGGCGTGCTGCTACACTTGCGCTGGTGATTAAGCGATGAGGATGACGACTTCTCCAGCGTGGTAATTGGCGAACGCGTATCCTGCACGGAGCTGGCCAGGCTGAGCAGCCGGTTCTCGTGCGAGCCGCCGATGCCCATTAGGCGCTGGTCCTGGAACGACATGAACTTGGTGTCCTGCCCCACGCCGCCGTGCTGCATGCTCGCGTGATCCTCCAGCAGGCCCTGTTGCAGACCCAGCAGTCCGCCGACCAGGTTCGGACGCAGCTCGTCCATGCTTAGCTTGCCGCCCTGCCCGCCGGCCGAGAAGTTCAGCTGGCGGCTGAAGATCGCCGGAAAGATGTTGAACTGCTGCGAGTCGGCGCTCGACTGCGGACTCAGGCCCAGGCTGTGCGGCGCCACGTGCGGCAGCGACGAGGAGGAGGAGGAGGCTGCTGCGGCTGCCGCTGCTGCTGCTGCTGCGGCCGAAACCGATCCTGTTCCCGCTCCGGACGAGCTGGGTCCGTTGCCGATAAGCAGCGTGGGTGTGCCGGCGGAGACGCCTCCGTTGTTGATCAGCTGC


Search Again