CR01661

CRIMIC CR01661

Gene Wnt10

CG4971

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGTTCGCAGTTGCTGAACCACGG

Amplicon 5' Amplicon 3'
TTATCTTGGCCTGCTGCACACGCTGGTGAGTCTCTCATCTATCCTAAGACCTAAAACGAATCCATCACCATTCGCGAGCTTGTAAAGCAAAACTCGTAGCTGTAAAATGCCTGTCGACATATTAACTCCCTTTCCAGTCCCGGGCTCATTACGCCGTGTTATTTGTGGCGGCCTGTTGGCGGGTTAATTAATTAAACGACAAGCGGCAACAGCGACAACAGATTAATCAATCGCCGCAGTGCGCCCGAGAAACAGCTGTCAGCCGAAGGTGTTGGCATAATTAATATCGATCTAGTGATAGGCCAGCGAAATTAAGCCAACCTAATTGTGCCCGATTAACTTAAGATTGTTCGCGGTTATGGGAATTACGAGGTGGAACGCAGACTGTTTTCACCTTCATGCATGGATTATTGTTTTGGTTTGGGAGAGCATTAAAAATAAGATGGGAACTAATTTAATTGTGAGATAAGAAGATGTTCAGAGGCAGACCTAAAGATCACCCAAAATATTATAAATAATAGCTCAGATACTAGTCATTTTTAAGTTTTATTACCCACACAGTGCTGCATTGTTTAAGCTAACCCATCATTCCTCGCAAGCAAACCTATTTGGCGGCCATGCCACAAAAATGGCAACTTACATGTTAGACCATTCGCAACAACGACCGCCATTTTGGAAGGCCGCAGCTTGCCACAAATGAAATTGCCAACGGGAGCCCGCGGTCGCCTGCTCCAACGGCAGTGGATGATTGGAGCCTGGGATTGCCGGCTGTCGGAGTAGGAATCGAAATCGAAATCGGAATCCCCTGCAATGT GGGGGCCTACACACAATTGAGCTGATTCCAATTGCAGGGTGGTCCCCGGCACTCAAGCTTTATAATGCGCCTGGGTCGCTTGTCAATCCGAGTCTTCTGGCCAGGCTCTCGATTTTCCATGTGCGCAGTGAGGCGGAGCCGGGAACAGGGTGCATGGATCTGGGGGCAATGAGCAGGGAGCAGGGAGCAGGGATCAGGGAGCTGGGATGGATGGATGTTGGATGTTGGATACTGGATGTTGGGTGCATTACTGTGCCTTGCCTGACTGGTTGCCTCGCCTAGTAGTTGCAGCTTGTTAATCTCGTTACTCTCGTTGTTGTCATACACTTTCAAAAGGTACTTTGGTTAAATAGGTTTAAATCCCAACAACAAAAAATTAAGCCCAAATACTCCTTTTTATTTAAAGACTACCTTACCTTACGTCAATATACATACTTTATAACCCTTTAGTCAGCCATTCAATATGAATATTGAATAAATATTTGTTCTAAATATAAAACTAATTTGCAAGGGTGTTACCATCTTCGAATCCCAATGGGGCTTCAACCTTTTCCTGTTTCTTGGGGTTGTCAACATACTTTTTGCTCTGCTCGTTGAGACTGCAGCAGTGCAACGATGTTGCAACTGAAGTGCAGCCTGCAATTCGCTGGCGATGCTGCTGCTCTTCTCGGCGTTGCCTTCGTCATCCTTGTAGTTGCAACGTCATAATTGCAACGCATAATGAGGCGAACACACACCCACATCCAGAGCCATGGTGCGCCACAATTTCGCCCGTTTGAAATGCAAATGAATTGTCGAAGTGCCACGCCTCCGGGACGCCAGTGCTGCAGTTTGCAGCTTAATTGGGTGCATACACAACACACATCCACGCACCCACTGCACACCTGCGCACAGGTGAGGCTGCACTGCAGCGGATTTCACACGTTC


Search Again