CR01636

CRIMIC CR01636

Gene CG8243

CG8243

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCGCAGTGCAGCTGCATGTGTGG

Amplicon 5' Amplicon 3'
CTCACTGTGCGAGGTGAACTGCGCCAAACAATCCAATGCGCCATCCACCAGCTTAAGGAACGAGCGCTCCGGAGCTACTGCTTCGGAACTCGATTCTTCGCTGTAAAGATGCATGAGGCGCTTCAGGCACCAGCGAATGCGGTCCAGGAAGTACTGATGACTTACCTGCTTTCAGAGGATTAGACATCATTGTGCAATGCATGGATGAGATCCAAATTACTCACCGAGACTGTGGTGCCGCATTCTAGTTTCATGGTGTTCTCCACTTGGCGAATGCAGATCATAATCTGGCTGAGGCAGAGGCACACCAGCTCCGAGCACTCCGACTGCCCCTGGGAGCAGAAGGAGCTGTGGGCCAAAGTAGCGAATTCCAATAGCACGGCGCACAGGTCCTGAAATTCAAAGCAACAAGTGATTGATGTCCTGGGGCTAGTGGTCCGTTTCCCCCACTTACATTCAGCCAGTTTGCAGCTGCTGCATTGTTCCTGTTCAGTATCAGCAGGCAGGCCTCTAGTTTCGTTCGCAAAATTTCCATTTTTGCCGGCAAATGTGAGTTCAAATGTTCTGTGGGCAGAAGTAAAAGTAAACAACTTTTTTAAAAAGTGGCTTCGGTTCCCTGTGAATGGCAAGATGGCACGGCTTGGCGTTAGTGACAACCAGGGAGGCTAGCTGCCTTCACCGCCACACGGTCCCACTGGACGCATCACTTTTTCGGTAGCAAAAACTTGTAGAAAATTGTCAATTCAATTCGCTGGTAGTTGTATATCCATGTGAAGCAGAGATAAGCTCCGCCAACTCTACCCGTCGCCCACGCCACGTCGCACAGTTGCGCCCCGCCACAAATATCGAAACCAGGCCTCACAGACCGCAAGCATACCCCAAAATGAGCTCCTCGAATGCGGGACAGCGCACGAAGCTAATTCAGGAGAAGTGCCAGACCCTCCTGACGCAGATGCTCCGCGACGAGGACAACAAGTACTGCGTGGACTGCGATGCCAAGGGTATGTTAATGGGGTCCACTTCTCCGCCAAGAGATACGCCTCTTGGTGACGCACATCTGTGTGCGTGCGTGCGTGGATATACACA CTGCACTGCGATATGAGCCTATGTGCTGTCACTGAATGCTACCTTTTATCCTTAGGTCCGCGCTGGGCCTCCTGGAACCTGGGCATGTTTCTCTGCATCCGCTGCGCCGGCATCCATCGCAATCTGGGCGTGCACATATCGCGCGTCAAGTCCGTCAACCTGGACACTTGGACGCCAGAGCAGGTGATCTCGCTGCAGCAGATGGGAAACTCGCGGGCTCGCGCCGTCTACGAGGCGCAGCTGCCGGACGGCTTCCGTCGCCCGCAGACGGACACAGCGCTGGAGAATTTCATCCGGGCCAAGTACGAGCACAAGAAGTACCTGGCCCGCGAGTGGGTGCCTCCCTCGCCGCCGAAAGTGGACTGGGCCAAGGAGATCGACGAGGAGCTTGAGCGCCAGAAGCGCAAGAAGAAGAGCACGCAGGCCCAGGCCACTTTGGGCCTGGCTGGAGTGGCCGGTGGCAGCGGCGACAAGCGCCTGTCCGGGTCATCTGCGTCGGCGCTCAAGAACACCCCCCTGCCCGCGCCGCTTCCAAAGCCGAAACCCAACCAGGTCGGCGGCTGCAGCCCAAAGACGACGCAACGCGTCCAGCTGAACAGCAGCGGCGTTAGCAGTGCCGGCGAAAGCGACCTCTTGGGACTGTCCTCGCCCACCAAGCCCATTGTCGCGACCAATGCCAGCCAAGACCTGCAAAACGAAAGTTTCACCAGCTTTCTCAGCGCCGAATCGATTGCCGGCCAGCCGGATAAGCCGATTGGCAGCAACGGCGACGCCGCCAATTTGATGGGCTCGAAGCCGAACTCGCTGGCACAAGAGGAGCAGGACTTCTTCAACCAGGGCTCACTGGGCGCCGGCGGCAACGAGAAGGATCAGTCTGGCAAGATGTCCAAGGACAGCATTCTGGCGCTGTACGGCAGCGCGCCAGCCACCCACAACCCCCAGATGAACTTTGGCGGCTTCACGGGCATGGCCCCAGGCGGCTATATGCACCAGCAGCAGCAACAGCAGATCCCCCACCAGTTTATGACACCGCCGAACTCGGTGAGCATGTATAATTCGCCAGTTATGGCTGCACCGAATGCGTTCAGCAATGCTGCCATCAGCAGTGCCACTGCGATGAGCATGGGCGGCTCCCATGGCTTTACTGGA


Search Again