CR01630

CRIMIC CR01630

Gene CG9701

CG9701

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATGTGTCGCCAATGACCGGCCGG

Amplicon 5' Amplicon 3'
GGGCGTTACCTGTTTTGTGGGCCTACTAAATGTAAAGCAGTAGGGAACTTTTCGACGGTTTCTATTAGCAGGAATATTGTACAACAATCTGGTTAGACCTGATAAAGATCTTTGCATACTTGTATCAAATGAAATTGTTTGCCATGTGACCCATTTCCAAAGAGACACTGATATGAGCAGATAAGTTGGCTAAGCACACTGCTAATTATGATATGATTATGATTATAATTGTTTAGACCTGTTTTATTTGCACAAAGTCAATTAAAGGTCTTAACAATGGGTATAAAAAGAATTGTGCACAGAAAAGAGCAAATACTATTTGGTGATATCTTTCATTTAATTTTTATCTTATCCACTACAACATTTAATAAATGCAGGACATGAGATATAAATTATTTCTATTAATTGCTGTTAATTGTTTATTTCTCAGTCGGAGGTTAGTGAAACAATTTATAATCCAGGGCGGATCTAGAAATCACAATAATTTTTGTATATTTAATAGCTACATTTAAATATAAGCCCGAGATTAATAAGATTAAGATTTGCATGCATTCATACATATCTCGATCTCCTTGCAAGATTCACCCGAATAAATACTCAATGAATTCACATTGAAATATCTGCAACATAGTTGCACTGAATTATCAATTTATCATGTTGACTGTGCTGTAGAATTGGTTAATACTGTCACAATTCGCTGCTAATGCCAATCAATAGATTTGCCGATTTCGCTACAGGTGCCAACTGCTGCATTTGCATCAGGTGTCATAGTTTTTTGTAAGTTTTTTTGTTTTGTATTTTTTTTTTTTAATTTTGTTATTGTTGTCAGCGGCGGCAGGCGATTTGAAAAATGGATTAAATGGTTGGACAGACAGCTTAAACGCCCCCTTCCTTTCAAATGCAATACTCGGCGATCGCGATTCAAATTGTTTTTTTCAATTCAAAGTCACATAATTAGCAATAGAGCGAGCCAAATCCAAAGCCAAAGTCAGAGCTCCGGGCCAAGTTGTGACAATGACCATTGGGCGTGGAAT GCCGGCCAACTGGTTTTCCATTCCCAATTTGGGTTTTTTCGGAAATTTGGCCCGGCATTCTTGGCATCGTTTCAAAGAAAAACCAAATCAATCCACACTAAAAAAGTCAGAATGCCTTAGTCTCATTTTCCGACACTTAACGTGTCCATTAGCAGGTTTATTTATCTGCTCACATTTCAATTTAAATGACCAGTGGACATTAATGTTATGGTTTTGATTTGTCCATATCAATTATTAAATTAGGTTGGCTAGTTTCGATTCGATTTTATGGTCCAACTAAGCAGGCGGATTATGTACGACTAGTTGCGTACTGGTTTCTCATATTTTGACTTTAATTGGTTAAATAAATTGATACGTTCTTTACTACGGCAAAATGTTGTTAAATAGAGAATATCATTTAATATCAGCATCAGTCAAACAGATTTGATATGCATTCAAATTAAGGGGATTTTTGTTCTTAATCAGCTGGAAAAATACTATAACAAATCAATTTAGAAGTGTAAGCTGTTACTTTGATTCCAACACTATTAATTAATATTAATTTAATATGTCAATTGAAATTTTTCCAGTGGAAGCGCGATGTGCAAATGGTCAAGGAGCTGCACGTGGGCACCTATCGCTTCTCCCTGTCCTGGCCACGAATTATGCCCGGTGGCTATATGAACCACGTCAGTACAGCCGGCATTAAGTACTATTCCAACCTGATCGACGAACTGCTGCGGTACAACATCACTCCGATGGTGACGATCTATCACTGGGAATTGCCGCAGAAGTTGCAGGAGCTGGGTGGCTGGACCAATCCGGAGATAATTCCGCTTTTCAAGGACTATGCTCGCCTGGTGCTGGAAATGTACGGAGATCGGGTGAAGATCTGGACCACCGTCAATGAGCCGTGGCATGTGTGTGAGCACGGTTACGGAGTGGATTATATGGCACCTTCGTACAACTATCCAGGCATTCCCGCCTACCTCTGTGGTCACAATCTGCTGAAGGCTCACGCCGAGGTGGTGCACATGTACCGGGAGCTCTTCC


Search Again