CR01622

CRIMIC CR01622

Gene schlank

CG3576

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 multi OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GCACTTGGGCTCGCGCAGCTTGG

Amplicon 5' Amplicon 3'
GGGTATGTTGCCCCCGTTTAAAACTACACTATTCTATTCTAGGTTTAAATACTAAAGGGTTCGATGTTCAAAGAAATATATAAGAAAATATAAATATCCGTACATGCTGGCAAATTCAATTAGTTTATTACAATTCAGTTAGTTGAAAACCATTTAATTTTATTTAAAGATAAATTACCGTTGCCAAAACATCGATATGCACACCGGTGCATGGCTCGAATTTTGCACGCATATCGATACTTGATGCCATCGCTATTGCTGTACCATCGCTATGAACTACTATCCTCGAACTTGTAAACAACAAAAAGCCACTTCATCTAGTGACCATTTGGAGCTGCCCGTCCGTTTGGAGCTATTTCACCTACTGGCTACTGTCACCACCTCACACTGAACCGCTCCGAAATGGAATCGCCCAGTGCCCGAACTCTCGGGAATTCCCTGGGCGATGACAGCGGCAACGGGAATGAAAACGGGAATGGAAGTGGAAACGGAAACACCACAATGATGCCGCATGGAATCTACCATGAGCGGCAGACACGTCACCTGTGCGGCCTCCACGCACTGAACAATCTGTTCCAGGGGCCCGACATGTTCTCCAAATCGGAACTGGACGACTACTGCACCACATTGACCCCGCGCAACTGGCTGAATCCGCATCGATCGTGGATCGGTTGGGGCAACTACGACGTCAATGTGATCATGTACGCCCTGCAGCAGCGGAATTGCGAGGCGGTGTGGTTTGATCGACGGCGGGATCCACACTGTCTCAATCTGAGCGTCATTTTCGGCTTCATTCTCAATGTACCGGCTCAGATGAGCCTGGGCTACTACATCCCACTGCCCTTCCACATGCGACACTGGCTGGCACTGCGTCGCTTGAACGGCAGCTAC GCACCGAGCAGCAGTTCCTCGAGTTTCTGGCCACCCAACTGCAGATGGATCACGAGCTATTCCTCGTGTTGGACGAGGAGACGGACTGCAAGGATAAGAGCCAGCAACGTTGGCTGCTACCGCAGTTCAGGGATTAATGTTATGGTTAGCACTCCAAATAAAGCTAAAATGGAGCAGTGCATTAGTTAATTGTACCAATTATTTGATGAAACTAACCAAAAAGTGCCCTAGAATATGCAAGTTAAACCTTTACCATCCATTTTGCACTGCAAGTGGAAGCCACCAAAATTATGTATGTAGTAGTAATAAAAGCGACAAGAATAATTCACATGTGCCATCAGTATGAACTTTTGAACCCTAGTTCTGTGCAAGCCATCATTTTCTAGCCAATTCATTAGAAATTTTGGACCAATCGAGAGCTGTGCCTTGCGGCAAAACGCCTCAAATTCGTTGGGTTTCGTGCGAATAATGATGGTGTTTTGATTGAGCTGCAACGCGATGACAGTTTGCGATTAGAGCCACCAGCAAGCATTATTTGAACGCATTTATTAAATTTCACTTAGGCAATATGCACGAATTGCGCTCAAAGTGCAATGCACTGGCAATTATTCGGCTCTTATCGCCGGCACAACTAAAATTTCGGAGCCCACTGGCGATCAAGCTGTACAGAATATATATATATATATATATATATATATATATATACTATATAGCATATATGTCGCCTGTTGTTTGGCGAATTACTTGCGCTTGTCAGCGATAATTCAGCACGCAAGGCAAACCGACGACGATTGTGAGATTAGCCCAAGTGAGTGCTATGGGCTATATCCTATATGTGGCCCGACTTGGGTTCTTTGGATTTTGGACGACGACGTCTGACTCACGGCCACCGATTGCCAGATGGAACTTGGGGAA


Search Again