CR01598

CRIMIC CR01598

Gene CG9095

CG9095

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTTCAGAGGGGGTGTCTTCGGG

Amplicon 5' Amplicon 3'
TCTCACGCAGCTTCTTCTCCTTTGTGGCGCGCTTCTCTTGACCCAGTTTGCTAAGCTTTTTGGTGTTGCTGTTTGCTGTTATTTTTTTTTTTGTTTTTTTTTTTGGTAAGCCAAATTAGTAGAACCTCGTTAAAATCGCACACAAACAAACCGACACACACTCGGAGAGTTGGAGAACATCGAAAAAAGATTTCGCAAGTGAGTCGACTTGCGCAATGTGGCCATTGTTGCTTTTGTTGGCGGATGCGCCTGGCCAGACGAGACTTGTGCAAGCTGCAAGTTCGTTGCCTAAGTCTTTTGATTTGAACTTCCGCCAGAGGATCTCACTTGGGCGACTTTTGGGCACTTATTGCTTGATGAGCACTAAGCGAAAATTTTGTGCCATATATATCATCTATAAAGTTAATTATAAAGTCACCTCTTGACACTTACAGGAGAAAAGCAATTATAGAGAGCAACGTAAATTTGAAGTATAGCTTATAGCATGAAGTATAGCATAATTCTAAGATCGCATTTGGTATTTCAGTAAATGACAAAATGTATGATGATAACACATATAATTAGGTTAGTATAAAGTCAAAGTCCCTAAGCTATTATTAAACCCAAACATATTTAATTAAGCAGGCCATGGTTTTTTTTTTCGGTGTCTCTGTCCGGGGGACTGCCCTTGGCTTTTGGTATTCCTCGCCAGCCGTTCGTTCTTGCCTTTTGGAATTAATTGCGCATAAAAATTGCCCATCATGCGCAGTAAATGAGACATCAAAGAACGTCTGCGAGCTAGTTGGCTGGCTAAGAGCTGCTAAGCGTATTAAATAAACATGCCAGCGATGGTTTCCCCCCCCCCCCCCCACCACTGCCACCGCTCTTTTATGTAACGGTACGCACAGCAACAATAAATTTCAAGCGTAAACAGTTACGTAAAACAACAAGAAGAACAACAGCAACGGCGGCAGTGGTTGAACAACCAGAAGAATTGCTGCTGGCTGTCTTCTGCTCACCACAATGACAGCATCCATTCCATACCATTCCGTTGGCAAGGCAGCATCTTTCACCC ATCGCTAGATCGGTGGGTCTAACTCGTAGCTTTATAACAGGTTCGATATGATTTTGCGGCACTTTTGCCGCAAAGGAAACGCTTGATTGCCGCTTCTAAACCAAGGCCAAGCAACGGCAATCGTCAGCGGACCATCGGCGCAAGCCAAAAAGACGATCGACGACATTGACCGACGATGCTGAATGCTGAACACTGGACTCTAGACTCTAGACTCTAGACTATAGACTCTAGACCATAGATACTGGATACTGGATGCTAGGTGGTGGTAGCTGGATGTTGGAAGCTGTAAGCCGTCTTTGCCGTTTGCCAGTTGACCGCATTCCAAGCACCAGCCAGCAAATCAATGTGCAAGCGTAAAAGCAACATCATCAGCCCAGTTGCGGTTGTCCTTCTCCTCGCTGCACAAAACAAAATCATCGTATTGTACTTAACATTATATGTGTATAATATTATACAACTGAAAGGCAAATTTAACAAAAAATTATTAGTTACAGCTAGTGCAACTAAATATCAAAATATTCTCAAATTTTTTCTATAAAAAAGAGAGCAAAAGCATGCCCAATTTGTTTCACTGTGCGCTGGGTTGCAAACTGGGTCACTTCGGCCCAAATGCAGTTTAAGATAGAATGCCAGCTGGGTGTGTGTGTGTGTGTGTTTGCCAGCTGCGAAACACCTGCAGTTGCAGCAGCAGCAGAAAAAGCAACTGCAGCAGCAACATCGCCGCTTTTCAGCTCGTGCCACAGTCAAGACTTCACAGTGAGTGATTGCAGTGGGGAAATGTGGTGAGCGGTGGCACTTAGCCGGCGCCCACTGTGCACTTTAGATGCGTTCTCATTGCAGTTGCTAATTTCTGTGGCTTTTGCATCGGCTTTTGGTTTTGTGCCTAATTTGCTTTGGCTGTGAACGTTCTCAATGCTATGCGAAGATTGCCCCCACTTTGGTTTTATGGGCTTTTTTTTTTGGGTTTTTGTTTTGGGCTTGTGGCCTGTGTCTGCCACCAAAAGTGGACAAACGCTGGGGTTAATCTTTTGGTCAGACCGCTTCCAAAAACACACCACACACACACACACCAGTGCAGGCAAGTAGTTAAAAAGAAATGGAAATGGTAATAGAAATAGAATAAAAAACAACAGTTTACAGGGCAATTTGCATAAGAAAGGAGAACACAAAGCCGGAG


Search Again