CR01589

CRIMIC CR01589

Gene Coq7

CG14437

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AAACGATGACTCCAAGTTCTAGG

Amplicon 5' Amplicon 3'
ATCTCATGGTGTGGCGCTAGCATCACGCATTTGAATCCACCGCGCCACAATCTCCTAGCGGGTAGTTACCCGGGACGATTGTGGTAATTTTCATTGAGATACACATAGAATCCGCATTTAATGCTTTATGTTGCATCTCAGATCAATCACATATGTATATACATATATGTATGTAATTTGTGAGTTGCGGCACAGCTGATTGCGTTACTATCGGCTATCGTCGGATGATCGGTCAGGGCTGCAAATGTGTAAATAAATTCGTAGTGTTTTTGATCTAATCAAAACCATAAAGTTGAGATGTTCTATGGTGTTGCTGCTATCATTAAAATAATATGAAAATATAAAATAAATATATGAACAGTTTGAGTCAATGGTCAATGGCGTGACTCACGAACGTGGTGCGATACCGGTGGCAGGCACGTGAGGATGGCCCATCCCTGGATTGGATTGCGCAAAAATAAACAGAACGCAAATTGTTTTTGTGCTCGGCAATTCGGCGAATTGCACTTTACCTAATAATTTATTTATTCAACACAATACATCTCGTGGAAAGCTGCAAATTAGCAATGAGTAAGTAGACTGCACTCAGTGGCTCACAACTGACCCTCGAAATCTTCGCTAGATCACGACGCATTAACTCTTAGATTTTGTTTTTATTTAAAAATGTTATGTTAAATTACAAAAAAAATGTATCACAATTAGAATTATTTTCGTTTCTTCCTTTTGTCGCTGTTGCTGTTGTTCTTGTCGTGCTGGTTTAGTAGAAAAGTGAAAAGTTGATTGAATATTTTGGATCGTGTGCGCC TGGAGTCATCGTTTCGGTGGACATGTCGTCGCTTGCCTGAAAACGATGAGATTAGCAAATTTTTATAAGCCCATCCTGATCACCGGACATTCCAGGATCAACGCTGCACTTACGACCGTTGCAGTGGCGTCCATAGAATCCCGGATGGCACTTGCAGTGCTTGTGGGAGACGCAGGTGCCATTGCGACACTTGCAGATGGAGCGCTGCTTGCGCCCGATCTCGCAGTGATCGCCTCGTAGTCCGTTGGGGCAGCGGCACAGGTTGTTCCCGATGCACCGTCCCTCGTTCTTGCAGGGGATCACACACTTGGCTGTGAGGGAAATGGGTGGGCAAAGGTTCAGTGTTTCGCCTCGATAAGAGTTGAGCCGTTTGCTACTCACAGTACTCGCAACGCAGGCCGTAGTAACCCTTGGAGCACTGGCACTTGTCCTTCTGTATACACTTGCCGCCATTCAAGCACTTGTCCTTGCAAATACCTGTTGATTACAATGGGATACTATTAGTTGCGCGCCAGGCACATTTCATTCTTATATAATGCCCAGTTATCTTGCCCCAAGTGTACTTAATCATCGCGTATCGTATCACCCTCCTTTTCTACGCAGATGGAATGCTGAGAAGAGGTCTTAGCCGGCCCGAGCCACGCCTGCTCTCCAAGCGCTATCTAAGCTCAGCAACTGGAGGAGGATCAGCAGGCACGACCGAAGGAGGCAGCTCTGAAACCACCCCGCTGCGTCCACGTCCAAATGCGCTCACAGATGAGATTATACGCGTCGATCATGCCGGCGAATTGGGAGCAGATCGCATTTACGCCGGGCAAATGGCCATTCTGGGCAACGGACCGCTGGGCAAGACCATCGGACACATGTGGGAGCAGGAGAAAGAGCATCGTAAACAGTTCGAGCAGCTCATTCAACAGCACCGCGTGCGTCCAACGATCATGACGCCAA


Search Again