CR01582

CRIMIC CR01582

Gene Pi4KIIalpha

CG2929

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTTCATAGGTAGCGTGGAGAGG

Amplicon 5' Amplicon 3'
GGCAGCACAGCTTATGCATCCATTTCGTCCACTTCGGATTCAGTCTGCCATAGGGTTCCTCGTCCTTTGGCTTAAATACGGCCAGGCATTGCTAAGGGGGAGCATCATAAGAAATGGCATAATAAATACATAGAGCATAAGCGGGTAAACAATATACAATTCACTATTTTGAAACTGTTTCAGGAAAAAACCAAAAGTTTTGCAAAAGCCTTATATTTGCAGTACTTCCCCGATTACCCGATCTTATTTATCTATGCGCGGAAAAGTAAAAGATCGACGAAGTTAGGCCCAGAACTGGACGACCCAACTCCCACCTTATGCGCAAGAACGGCTAGAAGATCGTCACCCCGATTCCCTACTCACATGGGAGGCATCCTTGACAAAGTAGGAACCACTGCTACCCTGGTAAATGCGCTCGGGCAGCACACCATTCTCGATGGCCCCCTCCGCCTTCGCCACGATCTCCGAGAAAAGCGGGTCATCTATAAGAATCAAAGATTAAAATTAAAAATAGGCATTAGCACTAGGGCTTTAAATTACTAAAAAAGTTTGTGCGTAGAACGAAGATTCGCATGCCTCAAGCGACGGGTAAAAAACGGACTGTTCGTCATTTATTAAAATTGAACAAATTTGCTATATAATTATGGTTTTAATAATTTATAAACACACCAACGAAATAACGTGCCATCTGTTGGATAAAAATAATTACAGCAAACATGCACGAAAACGCTTATAAGACTGCGATGAAATTCAAGACCCCATCCTACACTTTACTTTATATCAAGGAATGGCATAGGACTGTTGACTACGCT AGTTGTCGTTGAAATCGCCCTGCAAGTCCTGGCAAATGGTAAACACTTGCGGTATGAAGTTTTCGCGACTGCTGCTCGACAAGCGCGACATGGAGGCACTGGTATATTAAGTGCGCCGGCAGTCGAGAGGTTTCGAGTCGGCTGGCAGTTGATAAAGGAGAACCAGGTCACAATTAGCATAGCCAAAGCGTTTCGATAAGGGCCAACCCCTTGCCACCACTTACAGAGGTTCCTCAGCGGGCAGTTGGCACAATTGCAGCGCGGAGCCGCGATTTGAACGGTTACTGTGTCTTTGGAGTCACGCGCCATCGACGGTGAGTTCACCAGAAAGGGCGGATCGCCCTCCTTGTCCGACTGCGACTCCAAGAAATCCTTCTCCAGCGGGCACTTGTGCTCGCAACAGATGCAGGCGTAGGCGGCGGAGGCGGAGGGCACCGAGGAGCTGCTCTCCAGCGCATCCTTGCTTGTCGTGGGCTGCTCATCGTCTCTTGGTTCGCTTGGCTCTTGGTACTTGGCTGCTATAGCGTTCGGCAACGGCACCTGGCTGAGAAACGACTTAATGTTGTTTTTCGGCATGGGGCTATGTCCAATTGGCGACAGTTGCCAAAGGAACAAGTTCCATTTTTGAAGTGCCTTCCTCGAAATTCTTTATATGCTTCCCGACTGACTTCGATTCCGAGCTACAGACGTCCACGGTGACATCCAAGTACACCAAGATTTATAACACACAATTTTGTGCTCAATTTCGAAAAAAAACTAATTCTTGTAAAAACCATAAAATTGTAAAAAATGCTTTGAAATGTGGGGCGATGACT


Search Again