CR01570

CRIMIC CR01570

Gene CG1688

CG1688

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGGGGTGGGGTGGGTGTTTGTGG

Amplicon 5' Amplicon 3'
AGTGGGTGAAAGATGGCAGGAGGTGGGCGAATTGTGGGCACAAGTCTCTCGAGTCTTGAAGCCTCGATGGTGCACCTCCCCAGACATCATCCACCTAAAGGCCACCCGCCCCAATCGACTGAAGCTAGTTGCCGAGAACAAAACCGAAATCAAAAGATTTTCTGTGCCAATCTTTGCAGCTTAATCGAGTGATTTGAGGGCAGGGCTTTGGAGTTCATAAGAAACTAATTGGCAATGAATAACAATTTAGAAACAATAGGAAACTTTTAAAGAGGTATTTCAGACTTGTTTCTTAAATGATTGGTTTGCTGTCTTAAAACTTTATATTTCATTAGTTCTAGTAAAATTAGACATTGGCTTCAGTAATCTTGAATATTGAAATTTGTATTTCAGCTCCATGAACTACTATGGTATAGAGAAAACTTACTAATGTATTTATACATGGCTCTCCTGAGCCATCTTATGTTATTTCTGTTAATAAGATACTTGGGTCTGGTTATTTTGGTAATTAGAAATGAATTAGAACAGTTTTAATGTAGTTTTCATAGATTTCATATGAAATAAACGAGTGATGACTAAAGTTATTATTTAAACAAAGCAAAAGGATAACATATGGGAATGTTTCCATCTTCAAGACCACATGTACCATTAAAAATCTCAGCTTTCGTTGAAGCACATAATAAATGACCTATATTGCGAGCCAAGATGAACTTAGCACATCATTAGGCCTCCGTTAAAGGACTCGTCAAATTAATCATACGCCAGGTGGGACGCCTGTGCCGCGGATGAGCTCAAGTTAATTGGTTTATTTATTAGGTGAAATTTTAATTAAATAACATCGGATCTAATGCTCATGCACGTGCCGCTGTGCCGTTGGATTTTTTTTTTTCATCCAGTGCCACTGGCAGGTGCGACAAAGTAATTAATTTCACATAAATCAGGCCAGCAAATAAACCTCAAAATAGTTGCGATAAATTCGTGGAATCGATGCAATATCACTCCGTTGCGGAAGCGAATTAAATGGCCCGCCTGACCAAATATTTGGTTATGCAAATATTTAGCTATTATTCAATTCGGTAGCTGCGAAAATGCATTTGGACGGTCTTTTGTTTGCTTTCGAGTGGGGTG GGAGGACTCATGTTTGCTGGTACCTATAATTAAAATATTTGTTCTGGACCTGCGCTCACAATCGCTACTATTTACTTAGTATTAATGGGCGATAACAAAACATTGTCGCTTTAATGTGCGAATTACTTTGGCAATTTGCAGGCAAATCAAGCGTGCAAAACACGCCGAAAATTTACGGCCAATGCGGCAAAAATGTGGTGGCCATTATAATTTATGCGAATTTTTGTTCATCGCCAGCGAAGCGTACAAAAATTTGCTGCATATTTACGCAAATAAATTGATCAGTATAAGGATCAAAGGAGAGATACCATATTATTATATTTATATTGATTTCTCTTACAAGGACGTCATCGAAATTTATTTAAAGATTTTAGTAAATAAGTAGGCCACTTTGGCACACTCAATAAATTAAATGTAATCGCTATATTTAAGAAATGTGCGAAATATGTAATACAATAATAAATACCGAAAGAAATACTTTTATAGAAATATCAGGACAAGATATTGATTTTCTTATAAGATCAGGGGTAGAATTGATTGCTTTTGAATACACGATCAAATTGCATAGTTATTAAGGATCAGCTTGATAATATTATTTATTTTGAGAAACATAAGCTCACCTGTAATGATCCAGAGTTCGCGCAAGCAGTCCTCCCGGCTCTTGGCAATGGCAGCCGACTTGCTGATGTCCTGCGGCGCCTCCAGCAGCGGGAAGAGGAGCCCGCCCAGCACGGAGTAGCCGATGACCAGGAGCACCAGGCCGGGCGTGGAGAAGAGCAGCTTGAGCAAGTGACCGCAGCAGCGCCGGAGACTGCTGCGCGGCTTGGCGGTCAGCGAAGCGGTGGTCTTGGCACCCATCTCCGATCCACAACCCGCACCACCCACTCCGCCCAGGCCTCCGAATTCGGTGGCATCCGTCTCATCGTCAATGGAGCAGTCCAACTGAGACGGCTGCGGTTGCTTGGCCTTAATCG


Search Again