CR01566

CRIMIC CR01566

Gene CG17985

CG17985

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 long band no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CCCAGTGTTAAAGTCAGTGTTGG

Amplicon 5' Amplicon 3'
ACCAGCTCAGAGCCAATGACGCGGATAAAGCAAGCGTCCGTGCGGTTGGCAACGGCGCGGGCACACAGGGTCTTTCCCGTTCCCGGTGGGCCAAACAGTAGCACACCTTTGGGCGGCTCAATACCCAGATTGACGAACTTTTCCGGGTGCAGCAGTGGCGTCTCCACCACCTCGCGCAGCTTTTCGATTTGTTCCTTGCAGCCGCCCACATCGCTGTAGGTGACGTCCGGCTTGTCCTCAACCTGCATCATGGTAACCGTAGGATCAATCTTGGGAGGCAGCGGAATGTGGATCTGGTACTTGTTGCGGTCGACACCCACACGCATTCCCTCTTCTATGTCAGTAGGGGCCACCGAGTCAGCTAGGTCCACCACGAACTTGGCGAACTGCTTAACATTGATGATATACTTGGGGTCGTCGGAATCCGCGTTGATGATCTTGGTGCATCGGGCAACCTGCAGCGGTTGCTCGTTTTGCAGGATCTGCTTGTCGGCGGCCAAATCCCAGAGCGCTGGTGGCGCCAGACCCGTGTCGCTTTCCTTGATTCCAGTCAGCTCGTTCACCTGCTTCACAGCCTTTTGAATGTCCTCCTCGATGCTCTTGATGGATTTGTGATACTGGCTCTGCCCATAAGTCTTTAGAAGCTCAATGTCGCCTTCGTCGAGGGACTTGATCTCCTTGTCCTCCTTCTCATCGTGCTTCACCTTGCGCTGGTCGTCGCCCAGGTAGTCCGGCATCTTATTCGATTGCAATTGTACGGTTTTTAAGGCAAAAAATGAGTTTATGCGATGTTTTCCTTTTGTTTTACGGCGAGAATGACTGAACAATTTGGCATAGAGATGGGAGAAGCACCGCTAGCGCTATCGACGAATC TGGGAACTATCGATGTGTAGCCACTTTTAACTTCTACTGTTAAAATACAAATCTTAAACTTTTCCCAAAATTATTTTATGGTATTTCAATTGGAAATATACTAATTAGTAACTGGAGCTTAAATTTTTAACACATAAAATGTCTAAATGCTGTTATATTTCTTATCTTATCTTAGAGCATGTTGCGAATTTCCATGCATGTGTTTTAGTTCAAAATTGGTAGATATTTGAATTGAAATAGATAAGAAACTTTGTTATTTTTAAAGTACTGATATTGCTTGATTGATAAGTAAACATACATTCTGCACCCTTTACCTTACCTGTACTTTTATTTTTAAATTAAATAATATATATGTACACTCGCACTGAAATCAGCACTGACCTTTCTTCACCAACAGTGAAAGTATTTCAGAAATTTTTAAAACCGCGGCGAACTGTGGGCTTTCATTCCCAACTGCATCTTCTGTACTCACCTTCGTCATTCGGCGCACCCTGGGCTCCCTCGTAGAATTGTCCAGCAGCTCTGCTCGTCGATGGTTTCTCGTGATCCACGGCGCCTGAAGCATTTACCGCCGCCACCAGGAGTCGCTCATCCAGCATTTGCCGCGCATCCTCGAGGGGATTGCGTTCGGGAGCTGGTTCCCGCTCAATATTGTGTCTAGGACTGTTGTTCCCGCTGCGGTGGACCGCAGGAAGGGCTTCGAGGCCCCCGTTGCCCAGCAGGACGTTGTGCACTGTAACCGGAATGCGAATAACCCGATGTGCGTGGATTTCATTTTCGCGGTCGATCTTGTTCAGGCGCTT


Search Again