CR01564

CRIMIC CR01564

Gene CG42741

CG42741

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATCAGCCGGGTCATTATTGGTGG

Amplicon 5' Amplicon 3'
TGACCAAATGCCGATCACGATGATGACGATCGCTGCGGCGATAATGACGATTATTCCGATGGTAATGATGATGGCGTGGATGCGTGTGCGATAACGCGACGGCAGCCAATGTCGATGGACAAGCCGATAAATAAATTTATGCACAAACCAGACGAGGCGTAAAATGCACAATTTGATTTAATGCCTATATATGTGTGCGTGTCCCGCCATGGTGTCGGTATGTCTGTACGAGTGTTTGTGCAATGATAATCGATTTATGGTGTGTGAAGTTTGTTTCCTTAACGTATGCATTTTGTATTTCTTTTTTTTTTCCCCCCACTTGCCCGCCGCAATTCTGTTTTTCCCCTGGCCTTTTCGTTTTTTATTTTTTTTTTTGTGTCATTGCTAATTGTGTACAAATATGGACAAAAGCGTGGACACGGCCGCGAAGGCGAAGGCTTTCTAAATGGCCAGTAAGTAGGCAGAGTCGCTCTCGGCCATCGGTCGCAAGTTGCCAGTTGCAAGTTGCTAGTTGCAAGTTGCTAGTTGCACTGGGCAATCGACTGGGCTAACAGGCGCTTTAAAATGCCTGCGAGAAATAATTTATGCATTTCTTTGTCTGCCGGCTGAGATAAACAGCGGCAAAGCAGTTTAAGTGGTTTTTTCTACGGCTGCACTGCGTCGGCACAACTTTACCATATATCTATATATACATATCCATGTATAAATGAAACGCTGTGGACGGGAATTCTGATTGGGTTCGGATCGAATCGGATGGTGCATTAAATGATCATTTTATGCAGCATTTCATTGATTTATTGATGCGCATACGTAATCGATGGGCTGGCAGGCGCGGACTTAATGCAAGTCTTACTCAAAATATCTATATAGCAGCCAGTGATTTAAACTATGTTTAAATAGTTTGTGTGGGAATCGAATGTTGGAGAGGGATAAAATTATTACTTTAAATAGCATGTAAAAGTGTTAAGTATCGATCATAACTTTTATGATTCTTTATCAGACTCATGTCAGTGTCCTTAGCCCATTCAATATTGTAATTCCTTTATGGTGCCTTTAATTATTTATCACAATGACTGATCTCCACCGAATATGGCCCATTAGGTAGCCTAATCACGTTTATGGCGAATAAACCAAGTTTACGAGATTAATTAATGTTATTTATCTAGGAATTAGCACCCCCCAATCAGCCGGGTCATTAT TGCAGTTAAGCACCGACTTTTACAACCCCTCAAATCACCAAATGGAGCGCGGTCCGATCCTCGCCAGCCGCTTCTGGGAAGGCTCACTTCGAGGTTGAGTCGAAGTTGGCGCTGGGATAATTGGATCGCCGAGCTCCCAGCTTTTTTTGGGGCTGGCCGTAGAGTTTGAGTTCGAGCTTGGCTTGGTGAGCGGTAATTGCCGCGTGTTAATTCAAACAAATGTCGGGGATTGCACATTTAATGTGAAAATGAAGAAACATTGCGCCGCGCGTGTGTGTGTGTGTGTGCGAGTGTATTTATGAGCTTGCTGCTTGCCCCAAACGAGCGACTAGTAATATTGGCTAGTTTTACACAGCCGAAAATTTATATAAAACATATTATGTGATAATGTGAAATGAAAAATATGAAGCCTATCAAGTAATCGCATTATGCTTAGTTTATATGGAGTTTTTTTTTATGTTTCCTTTGAATTTATTTGTATAAATCAACCCTAGAGCCACACTTTTCTCACTGTGCAGCACGTTGGCTAGGTGGAGCGAGTGAAATAAATGATCCCGGCTTCATGTTTAATTTATTTGAAAGTTAACACACATATAACAACAGCAACAACAACAACTGCAGCAGCAGCAGCAGAAGTTGAAGACGAGGCCGGTGACTGTAAAACAGTTAAAATACTACAGCAACAACACGAACAAAAAAAAAAATGAAAAAAAATAGCAACAAAACGTATAGACAAGGTGGAGATGCCTGGACGTTTGTTGGCCATTTGGCTGCAGAGCACGGCATTAATGCGTCGTAATCACACTAAGCAGACATTAAATGCGTTTTCGCTGTTTGAGCACCACCAGCACCACCGCAGCAGCAGCACCACCACCATCACTAAAGATCCACGCAAAAAAAAAGGAGAAAAAAAACCGAAGACGACTGGCCAGGCGAAGAGGAGCTTGCAACTACAACATTTACCTGTGGCAGCGCCTAAATGATTGATAAAATAATTGCCTGCACGTGATGCTGGAGAAAGAGCGAGACGG


Search Again