CR01559

CRIMIC CR01559

Gene CG11665

CG11665

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACATTAGGCTCTGTTGCTGTGGG

Amplicon 5' Amplicon 3'
CGACAGCCGCTTTTTCGATTTCAGAAACACAATTTGCATTGCTAAAACCGCTCTCGGTGGTTCCACTAAAAAAAAAAATTAAGTTTTTCGGCATTCTCCTGATCAAACATCATCTGATGTATGGTCCTTTATACAAGTCAAAACAAAAGCCGATAACATAATACTTGATCTATTCTTACGCTAGAACCATTTCATCTTTCAAGATAACTCTCCCTAACAAGCTACTTTCAGCCATATGCTGTTTATTTTTTGCCGGATATTGGTTTGCAGCTAAGATTAAAAAAAAAGGCCGTGCAAATTAACATTTCCTCATTTGGCCAAATCACGGCACCGTCAACATTTTCTACTGCTTCTTCTTCAAAACAGTAAGCTAAATAAATTGTATAATTGTATAGAAGTGTATAATTTTATAAAATTTGTATTCTGATAACATCTTCTTTGCATCCCATATCTTTGTGTTTACAGTGCCTTGGTTCAAGTCGGAAATATTTGAACTCTGAAGTGTTCCCAAGTATTCACCCAATATACAGGCACGAACGTGCCAACAGTCTTGCGGTTAGATGAGCTGCAGCGCCTTTGTCAATTATATCGCCCAGTAAATACCGTTTTAAAAAACGCAGATAAAAAGCCACTAAAAACCATTAGATACCCGTCACTCAGCTAGTATACGAGTAGCTGAAAACAAGAAATTAAAAAAATGTTCTAGCACATCGACAAAAGTTGGAAAAAAAAAAAAAAAATCATTAAACAAACTTGAGCTGCGTCTATGTCTCTATAACCTGAATGTGCGATCTCAACTTTCTAGTTTGTCTTGATTATGAGATCTAGACTTCGAAGCGATAGACGAACATGGCCAGATCGACTCGACATGTGATCCCGATCAAGAATATATATTCTTTGCATGGTCGGGGTCGGAAACGCTTCCTTTTACCTCATAGATACTTTTCAAAGAATCCAGTATAGCCTCTTACTCAACGAGTTGTGGAGTCGAGTTTGTTGAGTATCACGGGTTGCCGATATTTTGGACCCGGCACCC GCAACAGAGCCTAATGTTTCAGTTTATCGCCGATGCTCTCACATCTCTTCCCACAATCAAATACAAGCCTGAGGTTGGAATCATGGTGGAGTAGGTACGTACTCTTCAAGTGCTAACCCTCACTGGTCATTTTAAAGCAACGTATGATGAAACTGGGAAAGTGCTCACACGCTTATTTCAAAGCAAAGGTAAGCATGCTTTCCAAACGGCAGCTTATTGAGGTTATTATTTTGGCAAAGAAGGCGTGTAAAGGAACACCCACTACTTTTTTTCTTTTTATTTTTTGAACTCAATATATATATATTTATTATTTATATTTACATATTTATTTAATAGTGCGATAAGTAATGATTATTTTTAATTTTTTTTAACTATCAGAATCATATAAACATTCGCGCCCGTTTAAATTCAGAGATGAGTTTATCGGGTCTGGAGTTTTCAATCCTCTGTTTGTTTTTTCAGGAGCCACACATTGCTCCAGCGTCCTCCACGTCTTTAACAGAGCCTTATTGTATATTGAGAGGTTACTACGTAAAATTTTATTTTCGTTGCAGATTAAGATCAAGTTTTCTGAATAGAAAATTAATAACTCTACAGCATGGACTAACACACTTCAACAAATTTTTAAAACTCTATGTAAAGTTCAAATTTAATTTTGAAAGTTCGAAGGGGACATCATTACTAAATACACAAATAGTTAGGTCTAGACTCACAAAATAAGCAACATGTTAAAAACTATGTGTTTTTTACTTACACTTACACTTAAAAGTGTATATACATTTTACATTTTATGGGTGTTTCAACCACAAGGAAGGTTGAAAAGATGAATTTTAGTATGCACTAAAAAAAGCTCACGGATTTATAGCTGTTATTTTTAACATCGGAGTGTTAATTTAATCCGTTCAGAACCAATTTTTAAGAACATATGTTTGCCAATAAAACTGGTTAAATTTCCCTTAGTGGACTGAACCCA


Search Again