CR01547

CRIMIC CR01547

Gene NAAT1

CG3252

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCGAGCCGTACGCTAAGTTATGG

Amplicon 5' Amplicon 3'
AACGCGGTAACTGTTTTGCCGCTTACATATTTGCTCATTCGGGGAAAAAGCTGTTTAAATAAAACAATAACTCAGCTGGCCGAGTGGGCGGGCAATTACGAACGAAGTTAAATGGCAAAGAAACTGCATCATCATAGATACATAGATATGTATCCGCCAGTACGGTATCTATGAAATAGCCGAAACCCATGTGTGTTTGCTTATCCCATTTTATCTGCAAAGCCAAAGGCTCTCATTACCTTTCCATTAAGAAATTTATATATATAGTATCTATATCTATACATAAATATCTACCAGCTGGCTGTTGAACCTCAAACAAACTCGCATAATTGTGGGGTTTTTTTTTCTGCGTGCTGGGAAAAATTCTATCTTGGGAATCGCCTTAATTGCATTTGCCATCAATAAAACCTATGCTGACCGCACTTTAATGAGGCTTTGTTTTGGTCTGTCAATGTCACTCTGTGCGGGGGGATAACCCTGTAATTTAAATCAACTATAAGTATAAATCTTAACGATCTGTGCAGCATCTGCATTTTGCATGCAAACAGGCTGAGTTCTAAGGGGAATTACCTATAACCATATTATAGATATATATTCATATATATGTATATATTTATAGAAACTAAAGTTTTTAATCACCCGCAAGAACCAATTCTATATATCTTCGTATCTTTGTAACTTTTTTTTTTTACAATACTTTCTCGGAAATGCTGTAATATATAATAGAGGGCTGCAAAGTGAACCTGTCACTCCACCGAGCACTCGCCTATATATATTATAGCTTCGTCATATGTTTATGGCTGCTGCAGTGAAAACTGGTTTCCAGCTCTTCGGCCATATAGCGAGTATAGTACAGTATAGTACGGTATAGTACGGTATAGTACACTATAGCCTATTATAGTATAGCTTTCGCTGATCTCGAGCCGTA GTTTTCGGTTCATTCTTCGGCTGAAAATAGCTCTAAGATACATTTATGTGTCGCTGGGTATCGTAAAGCGTATAAGATATGCATGGAGTAACCGGCTGACAAAGTCTTTCACCCCACATTGGGGTGGACCGTAAATCGCATATTCGTTTGTCGGTCGATTGGCCTGCAATTAAGGTCTAACAGCCTTAATGATCATAAAGTCATTTGGCGATTGTAAAGCCAGAAACACTGAGCGAATTGCAAGGACGGTTGTGAAGAAGGGCCAATCAAAGCATAATTTCGGGGTAAAAGTCCATTGAAGTTTTATAAAGTTTATTGCATGGGAAATGTTTCTTCACAGTGTACATTGTGAAACTTTCATGCACCACACGGCGTATACTTAATGTTCCAACTGTTGAACACTGCCTTCTTCTAATCTGAATCGCTGGCCACTTGAGTTCTTCAAGTGCCACTCGAAAGCAATTCCATTAGGGATACTATTAATTGCCTGATTTCATGGTCTAACACTTACTTCCGTTGATGCAGCATTGGTGGCTCCATTTCCACTTCCATTTGAGCTGCCATTCGATGGCTGAACTCCTTTCAATTCCATTTTTCTAGCCACTTGTTAATTTTCCCGGTTAATGAAAACAGTTGACGGCTACTCGCGTTTTGCTTATTTAATTACTAATTATTTATTTTTTTTTTTTTTGTTAATAGTAATTAGCACATTGCATTTGGCCAGCCCTTGGTTACGGTTGGTTGGGTTAGCGTCCAACTGCAGTTTCAGGGTTTAGTTTTCTGTAATATTTTCGTAATTTGGGCTGTGGATTTTGGCTACTTGGCGGTGCTGGAGGCGCGCTTGTGGTGCCGTGAATGCCGCGGCTGGAACTGAGAATATTGCGAGTGCCGGCCGCTTTAAGAACCGCCAAAGTCAAGCAG


Search Again