CR01535

CRIMIC CR01535

Gene Tsp5D

CG4690

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CAGCTCGACGTAGACTTTGGCGG

Amplicon 5' Amplicon 3'
CCAACCAGGAACTCGCTCATGAACAGCATTACAATCAGCATAAAGTACTGCGGGTAGATATGATATTGAATGGCTTTGCACAGAAAGAAAATGGTCAAAAAAAAGTACATAGATCACAAATTCGACATGCATGTATGCCATGAGCTAAATCCTCTCCGTTGACCCTGATTTACCCCCGATTTACTCACCAATACCAGGAGACAGCGGGATTGCACCCAGGCGCCGCAGCAGCCAAAGAAGCTGACCACAAATCCGGTGCCCCCGATGCCCATGAAGATGGTGTCCGCACTCAGACCTGCGTGCTGGGGCAGCAAAGTGGCGTATCCCGCGTAGCTCAGTCGCAACCAGAGTCCCGCTCCTAAAAACGCACAGCTACATAACTGCAATGGGTCAGGTTGGGAATTGGAAATTGGAAAATAGAAATTAGAAAGGCACTGATTATCCAGCAGAATGCTCGAAAAGTGAGAGGTGGTAGCTGCATACCTAAAGGACTCAAAAAGCTTAATATTTGATATAAATCAACGAGTCAATTATTCCAGACAGTGTCACCTGGACACAGACCTTGATTTATTGCTCTTTGCTGCACGAATAGCTGAAGGATCTATCATTCAGAGGCGAAATCAGATAATTCCCCCGATTGACGGCCAAATGGAGAGCTTTCGATTGCAAACTGTTGCATGTTCACAACGGCCTGACATCTGACATTTTCAGGGACTTCGGGGGAAACCCAGTGGCAAGCAAAAACAAAAGCGGACGGAAGCTGCAGCTGCAGCTCCAAAAAGCTAAGGGTAAACACGCCG ACGTCGAGCTGGAAACTGAAACTGTGCTGAAAGCAAAGCCAAAAGCAAACGCAAAAGTCAATGACAGGCGCTCAGACAATGCAACATGCTGTCACAAAGACACTTCCGTCGCAGACGACGGCAAAGTTGTGGCTCTGATTAGCCGCCCTACGTACTGATTTTGATTTTGCCTGCGATTCTGATGCCGCGCATATCCGTTCTGGGGGAAATGGAGACGGCAGTCAGAATATATGTATCTTTCCAGAAATGTTTACTTATAGGCATAGAGGTGTGTATTTCAAGTCAACTTATTAGTAATTAGTAGGATTTTTTACTTAAATAACTTGCCCATAGAATGATGTTGAGCCAGCAGAATGTGCGGCGTATGCAAGTGTAGCCGGCATTGCCCATCGCGGGATCTGAAACGAAAAAAAAAACCATCAGGTAGAGCTCGAAACCTTTAATAGTCCTTTATATTTAGTGTAATTCCATCCTAAAAAGTATATCCTGTGGAAAAACCAGACCTTGCATCCATTAAACATCCATTTTGAAGCAGCAATTGCAATTCTGTTCGTTTATATATCAAATATAGTTTACTGTTATTATTATGTGTATTATTACTATGTTTTTTCATTGGCATTTCCTTTTGTCAGCGCCATGTAACTGGAGTACCCACATGTGTGTATGTGTGTGTGTGTGCCAGCGGGGGCGATTCGTTAGGCAATTGCAGCTGCAACTGCTGCACAAATGCAGTAATCCACAAATGTCCACACATGGGTAGACACTCGCTTATGCAAATATTTTGTATGATTGAATGAAAACAATAACTAAATAAAAAAAAATAACAAAATTAACAACAGCAGCGACCGCAATGACCATGGTCAACGAAGCAGATGAGCAAATAAATGGGTGGGTGTCCTCATCTGTATATTTAAACTATGGATGGCAAAAAGCATTCAGGGCCGTCCATTTGTC


Search Again