CR01527

CRIMIC CR01527

Gene CG11155

CG11155

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GAAAGTATGACAGGCAAAACGGG

Amplicon 5' Amplicon 3'
TGACGGAGCCTCGGATGATAATACGGTGGATTTAGTTCGAATCCAAAACAATTTTACTTTAAAAAATAGTTTTTGGTTTGCCATTGGGGCTCTTATGCAACAAGGTTCTGACTTATATCCTAGGGTACGGACTATTCATTAAATCTAAAAGTCACTACAAAAAGAGTACCAACGAGTAACAACAATTTAAAGACAGAACGAAAAGTAATTTTATACATTTGTGGTCAAAACTATTTACAGAAAATGCAATTTGATGCAATTTTGATGCAATGTAAAATTAAAAAAAAAAAATAAATTGCAGGAAAAACTGTGTATACTTTAAAGACAAAAGTTACATTTTGGTTGCTATGTTTCGTTCATGATTATATTTATATTCCGTTACTCGTACAGTGTAATGGTTTAACTTTGATTAGATTAGTTCTATGTTATTTAATATGTAAGAATGATTATTTCCGACTCTATAAAATATATATTTTTTTACCAGACGAGTTGATCTAGCAATGTGCGTTTGTCCGAATGCTGAGATTTGTCGAAGTAGACAGAATAATGAGAAGTACAATTTTTAGGCGTAAGAGTTGGTCTTGCATTTCAATACAAACTGGAATGAAAAATGATAAAATGAAACCATTAACAAAGTGAGAACGCTATTGTCCATTTTCATTGTGGGCGTGGCAGTGCGATACAAATGGGCAAGACAAATAATAAAAATCTAAACATATTTCAATAATGTGGACGCAGATTGTGGCGTAGCAACTTTAACTGCGTCTATGTTTATTTAGTTTTCATAGTTCCTGAGAAGAATGCGTTCATAAGTAGACGAACATGGACCCATCGACTAATGATAGTAATTGTGTGCAATATATATACATGCATATGTACATGCCTTGTATAATCCCGT TTGCCTGTCATACTTTCACGAATCTAGCAAATCCTTTTATTCTGAGAAGAACGTGTATAATTAATACATTTTTTAAAATTTTTCGTTGTCCGTTCGCGCAGCATGTGGCATTAGGGAAAAGGAAACGGTTAAGAACGGTTTTCCGAAGTGCGGGAACTTTTAAGTTAGTACTGAATCTGAGTCGACTCTTAACAATCTAGCGCAGTTCCCGAGATATTTTATCATATACATATCTCAAATCTTAGCATGGACGTACAAACGGTGGACAGGCCCAGATCGACTCGTCTGATCAAGAATATGTACTTAATATGGTCGGAAACGCCTTCTACCTATTACATACTATTCAACAAATTAAGTATACCCTTTTTCTACTAGTAACGGGTATAGGAGTCATTAGTATATTATACTAGTTATTTGTAGAGTAAAAGGGTAATATAGTCGCGATATTCAACGATACTGTTTTTTTTTTCTGTAACTAATTATATTTACAAACGCTTTCAATCCGAATACTTTTTTGTCTTTTTAGGCAACCTCGACGCGTATTGTGGGCGGATGCTGGTTCTTTTTTTGCCTAATCATTATATCTTCATACACTGCCAACTTAGCTGCATTTCTAACAGTTGAACGGATGATTTCCCCCATTGAAAGCGCTTCTGATTTGGCAGAGCAAACCGAAATATCATATGGAACTTTGGAAGGTGGATCGACAATGACATTTTTTAGGGTAAATATTTCAAACAAAGGACATACGCATTTTAAGTTTTATTTGCACAACATAATAATATTTTTGCATAACGTTATAGCACAATAAATTGTGAAACTGGTAAAAAAAATGATATGACTAGCAAAGTCAAACTTATCTTGCTAAGAAATCGAAAACTGAAATAGGCAAAGAATGGGAGATTCAACATACTGAGTATAAAATGGCGGTGGTACACAAGATTGTATTAAAACTTTGTAATACTCGAAATGTACAAAAAGAATTGTGTGCCTAAATGGTTTTATTCGCGTCGCTCTTGGCAATGCGGAAATTTAGCTATGTATTTTTATACCTGTTATTCGTAGAGTAAAAACTTTTTGCCACGCCCACTCTTACCCCCTAAAGCCGC


Search Again