CR01512

CRIMIC CR01512

Gene Corin

CG2105

Information

Donor Location Cytology FBti Stock number
pM37-p02R:7556397..755640543D5Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence CAGGTGCAGAGGATGAAGTGGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GCCAGGATCTTCTTTGGCCT GCAGGGGACTAAGCCCTG CATCCTCTGCACCTGGATGG CTGTACGCATCCCTGGGATC
 
Amplicon 5' Amplicon 3'
GCCAGGATCTTCTTTGGCCTATAGTAAACGACTAGATACATCTACTAACTATGTGTCAGATTAGAGAACAAATAATTTAAACTTCTAGTTATGTTATGTATCCAGAAGTTTGTTTATAAAGATCTAAAATCGCAACTGATAATGTAATCGCAATCTGTATTTACCGCGAATTTACGAAGAAGTGGTCAAATTTCTACCGGGCTCAGAATACTTTAAGAAAGCCAGATTTTTCCGGAAAAAAGGATATATTTTGAGCTTTTCCACTGAAAAGAATTGGCGAAGCAATCAGCTTGGCATTACTTTCTCAGTTACCAAATTAAAGAGCAGGTGGTAGTAAGAAAAAAGGATAATACGATGTCTGTTAATTAATATAATATACGAGTTTCCTTTACACATTTCAAGCGAACTGCACTTTTTGAGAATTTTATACGCAGGGAAAAGAAGATAGAAACTTTCCGCGAAACATTCGAGTTTTTCCCTCACAATAGCCATTCATTTTGAAAAGTTTTTTTTGGAAGTGCAGCACAATACAATTTGCTGCAGAAATGAAGACTGCGAAAAGACAAAGGAAAATGGAATTAACGGATGTACATAGAACTGACCCTTAATGAGAAATTTCCTCTTCTGCATCTACGAAAATAAATAATCCTTCTATTGCGCTTTTCACGGCGAAGTAAACAAAGCTGAAATTTCGAAAAGTTTCCTCAGTTTCGCAACCGCCAAGGAAACAGTATTCAAATTTAATACCCTACTCATCCTCGTTTGGGTTATTCGACTGGCGTTGCACCGTCAAGGGTTTCGAGTGAAGGGCAAAGAAGATGAGGGATTAGCTATAGTTTGGCTTTGCATGACTCAAGAGATCGATGTGGACGGCAGCCAAAACCACTTGCCTCTGTTCCTGATTCATTTTCCAGCAGGAGGACCTGGCCGCAAATCCCCCCAAAGTTATTTCCTGCGCGTCAGAATTTCTGCGCCCGGCTCAGCCAGGGCTTAGTCCCCTGC CATCCTCTGCACCTGGATGGGGCTTAAAATGCAGAATATTGCTGCTGGATAATATTGCCACAGTGGTGGATCGAAGTAGCAAACATTACAGTGGAAACAGGTTTCTATCACCAGGGCAATATATCCTATATCTTTTTAACATTGTGAAAGGCACTCAACTGCATTACTAAGAAATTTCATTTATTATTTCCTTATTAGAGCATTTTAAAGTTACAGCGTAGGTTGTTATTTATATATTTAATATTTATACCTTATAACCCCGTTTAGTGATACAAAAGTTTCATAAAAGCTAGTCATATTTATGTTTCTTTTTAGAAACATTCGCTCAGACAAATTTCCATTGTTTGCTTTTACCACAAATTTTCCTCGATTTTCGCTGGCAGGTAAACATGACGGAGCAGAAATATTGCCAGTCAGCGCATCAGGGTGCCTCCATCGCGGGAGGAAGGCAGGTCCACCACCAGCAGCAGCACTTAGTGCGGGTGGACACCCCAGTGACGCCCCCACCTCCCATTCCGCGGCGACTACTGCGCGGCAAGTCCGCCTGGCAGGCGTCGAGTCCACACCCACTTCCACTCTCGGCTGGCGGACAGGATGGCGCCCACGGCACGGGCACGGGCACTGTGTTTGTTTATCCGCAGCCAGAAAACGTGACCGCAGAGGCAGTGGTCCGAGGATCGGGCGACGGACAGGGGGGCGGAGGTGCCGGGCTGCAATCAGCACTGCTTGTTGACATAGCCACACGTCCGGCGTCCGGATATGCGGATGCCGATGGGATTTCCGATGACGACCGCATGAGTCTGGAGAACTCCGTGTTCGACGAGTCGCTAACCTCCACGCCCGTCAAGGTCGCCGGCTATTTGGCCGGCCGCTATGCCGGGCTGAGTCACATGGCCAAGCGGGCGCAGCGTTCCTCCAGCAGCACCGTGGACTCCGCCTACGGCTCATCGCTGGGCGGCCACAGTGAGCGGTTCGCTAGCAGCTCGACCAGCGTGGACTTTCGCAGTCGCTTCTCCTCGGTGGACACCCAGTCCTCGCTCGATGAGAAGCCGCTGTCTAGCTCGATTGACTCGCCGCTGGCCAGGGATCCCAGGGATGCGTACAG
 

Search Again