CR01493

CRIMIC CR01493

Gene sti

CG10522

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GACCCGAGGAAGTAAAAATGTGG

Amplicon 5' Amplicon 3'
TCTCCTCGCAATGGGAGAGAATCTTGGAGTATGTCTCGTGTACATTGTCCTCGTGAAAAGGTGTTGTCTCGCATATTAACTCATATCCTATAATGCCCATGGACCAATAATCGCAGCTGACCTACAAAATGAGTTCTTGTTTTAGCTATGAACTTTCCAAACCAAACTCTGCGATCGTACAATTCTACTCACATCGTGCATCGACTTGGACAGCTTGTAGGTGGATATGGTTTGCAGCAGCTCTGGAGCTATGTAATCCGGTGTTCCCACCGGCGACAAACTCAGCACATGGCCATCGCGATCCAAGGCAGCGGCATTACCGAAATCAGCCAGTTTAATATGGCCAAAACGATCAATCAGTATATTTTCAGGCTTTATATCCCGATGCACATAGCCCATCTCGTGCAATGTGTGCAGGGCCACTGTGAGCTCGGCCAGATAGAAACGAGCCAAGTCCTCATCGAAAGGGCCGTGGCGTGACATCAAGCTGAGAAGGTCTCCGCCGGGCATGTACTCCATGACCAGGTACAGATTGTCGTTATCCTAAGTGATAAGTTAATTCAAGTACTGAAATATGCGAAAATGTGGAAATAACAAACCTGAAAGGCATACTGCAGATTGATTAGCCATTCAGAGTTGCGAATGGACATGATATCGCGCTCCTCCTTGACTTGTGACGTCGTCACCACCGACTTTTTGATCTTCTTCATGGCGTATATGTCGTTGGTTTGCCGCTCCACCACCAGGTGAACGTTGCCAAAGTATCCTTGGCCAATAAGCGTCTTGATGAGGAAGTCATCTGCGTTGACCCTGAGTTTGCGGGTCTCCTCTATGATGGGACGAACTGGAGTAGGAAATTAGATAGTAATATAATGGGTAACTAGGCATGAGCTCTATTTTCAAGGAGGGAAACCGGAACATACAGGTAAATCTATAAGAGATTCTACTCCCAATAATTTTGTGGGCTTTAATAATGGAATATGATTAGCAAAAGTAGATTCTCTGACCCGAGGAAGT TGTGGCTTCTGAGTTCCATTTCTATAGAATGGTAGATACTCCATCCGAAAACCCTGCTGACCAATGCAGTTGACTCACATTTGTTGACAAACTCGGCGATGTTGCGATCGCGCTTCTTCAGCGTATCCTTGTCGCACTCGTTGTACAGCAGACAGAAGGCGTCCAGGAGTCCCTCGCGGCAGATGGCCTCGGCCACGGCGGCGCTAGTGGTGCTCACGGGTACAATGCTTCTCCTGGTGGAGGCGGGAATACCTGATCCGGAGGCGCTTCCAGCGGGCTTCGCACAGACGCCAGCTCCTTTGCCCAGAATCAGGTTGTTCAGACGCGCGGTGCGCACGCTAATCGGCTCCATCTTGGGTGGCATGATGGACTCACTTTTATTTGCAATTTTCTCACATAAATAATACAATTAGAAATCCGTAAAATGCCAGAGCATTTTTCTGCCGTTTCGCTTTGAAAAAAATGCGCCGAGGGAAGCCGAAGAGCCAGGGATGCGTGCTCACTTTCCAGAGTTGTATTTAGGGTTGCAAGTAGGGCTGCCCTGTGAAAGAGGATAAAATTTGAATTTTAATGCAAACAGAGAACGGATAAATAATGAAATAGTCTTATTTACTTTTGGCAACCTTTTGAAGCGTCCCCTTTTATATTTTGCACAGTTTTGCACATAAACAGTTATTATTATTATTTCGCTGCCGCCGCCGCTGCTATACAACCGCGCTTTCCAACACCGTCGAGGCTCTCGCTCGTATGCATCGTTCATTTTCGACGGGTAGGTTTTCGCAGACGGACGGAGCAAAGATTTGTGCATCGAAAATTGCAATTTTCACATTTGGAGCCGTGTGTGCAGCATCACAGACATTGGAAAAGCGCTTGTCGCACTTGTGCAAAAACACAGCTTGATAAAGCAAACGCGGCTAGAAGGCGATTGGCCGCAAATTCGCCCTGGAACTGGAACGCAATTGCGTGTGAAAAAAAGACGGAAAAAAAGTAAAAGAGCAGAGACTGAAACCGTCGAGAAATCGTTGTCGTCGCG


Search Again