CR01488

CRIMIC CR01488

Gene put

CG7904

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TATCGGTTGGAAGTGCTCAAAGG

Amplicon 5' Amplicon 3'
AAAACGAACCAGCGAACGTGCACAGGAGGGCAGAAATTGCAACACATGCGGCTCCGAAAAGGGGTTGCTGGAGGCTGGGGATGTAGAAAATGATGGGGGAGCGGGCGCCACTTCGCGTCAAGAGTTCGTTAACACGAAAAACGCTGCCTCGGATGCGAGGAGTGGTATTTTGTAGGCGAAGCCTACGCCCTCTTTTTGCAACTTGAAGATGCAGTAAAAATACAAAAAAAAAAAAAAAAAACGAAATAACAAAAACAAACAAAAAATATATGCAAACGGAAAAATAACAAAATTGGGGTAAACACTCCAAAGACAAAACCCCAGTAGCAGCAAACGTTAAACCGAATCTGAATCCGAAACCGGATCCGAACCCACCTTGTGTGGTTGCCTCCGTGGTGCTTTTAATATATTTCTGGTTGGAATTGCACCGCGATCCCTTGCAGCAGCAGAAGTGAATGTTTCCCTGCCGTGGCTCTGCACTGGTCACGCACTCCGTCTGATTGCATTCGTGCATGTCCGTGAAGCAGCCCTTCATCTTGATGCGCAGGATGCCTATGGGAACGGAAAAATTAAAATTAATCAGTATGCCTGAAACAACGTCAACTTCTGCACGGCTCACCCGTTGTCTCGTTGACCGACCAAAGGACATAGCAGCTGGGAAACTTATCCGCCTCCATCTTACAGTGCTCTATCCGTGTTTCACATTGCTGCGTTGTGTTGCACATCTTCTCGTCGAAGTGCTCGCATTCTATGATCCCATGACTTCCGGGCAAAATAGATCCATGGATTCCAATCAGACAGCAGACTAAATGAAGACAATGGGAAAATAGATTAATAATCTTTCTAGTTTTAGATTAGCACTGATCTATATTTAAAGTATATATTTGAGCAGTCCTAAAACATGAGTAAAGACTTTCAAAAAGTTAAAACGTAGTTAAAGATCAAAGTTAATGGAATTATCGGTTGGAAGTGC GTGGGCAAATAAAGTCGAGCCTATTTGGGGAATAAGACTGAAAGGGAGGGCGCTCAGCGAGCTCTTTGTGGGCGCTATCCTTTGTACACATATCGCATGCCCAGAAGTAGCAGGAGTAGCGTCCTAAGCTGGGGCCTCTGCCATTGAAAGCCACCCCATTTGGGCACGGAATTAGCCCCACTGGCCACACACCAGCCTTTGAGTGGGCATGGCCCCAATGCACGGATATGCAGTGCACAGTGGGCCTGCAGTAAGGTTTCTTGAAAATCTATTTACATTCTTTAATTCGATTTAATCTGGGATCCTCATCCAAATACCGAAATTTTTGTTGATAAAAATTAAAATGATAATTCACTTTTTAAATGTGTAAATACAAAAAATTTAATTTTGAAAACGTTTATTGCAACGAGCCTGCGATATATTGATTGATATTTCTTGACCATTGGCTAAGCAAACTGTTTTCAATCCTTTGAAACACTTTTCGTCCCACTGTCCTTTAGGTAATCGGATCGCTGGCCATGTATGTGTGTGTTCGTAAGCGTGCATGCTTTATAGTAAAGTAGATACATAAGCAGGCACATTATGCACACAGAAAGGGATGGGTTTAAAGTGGCGCTTGTGCGGAAAAAGGAAACAGCAGCAGCAGAAACAACAACAACAACAGCAGCAACAGGGAAGAGAGCGCACTGCGCCACAGAAAGAGAGAGGGCTATGGCGAGCGAAAGAGAGGGAGGCCGGTGGAGCAAAAGGGTGGGAGAAACCAGAACCTGCCATACAACAAGTTCCTAATGCAGCAAAATCCATTCAAAGAAATGCTCAGCGCACACACACATGGATTAAGATTGGGAATTAGGTATCCGATCGATTTATACCGAGTATGCGTTTGGCG


Search Again