CR01484

CRIMIC CR01484

Gene CG10631

CG10631

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTTCGATGGGCGTGTGGGCGGG

Amplicon 5' Amplicon 3'
GGCGGAGATAGACCTGCTTCTTAAAGAAGACCTCCTTGCAGCGCTGGCAGATGGGCAGACTTTCATTGCCCCGATCCGATTGTTGTTTGCGACGCAGGAAACTGCTAGTGGTCTAGAGAATAGAAATTATGACTACGGTGAGTTTCGGCAAGGAACCATTATAAACTCACCCTTCCGTAGGACTCATCCTTTACGGTCAGCTCCACTTTCGGACTTAGCATGTCCTCGCTGAATTCGCTGAATTTGCTGAAGTCAGCAAATGGCGTATTGTCGTCTATATAGTTGGACTTGTAGGAATGCTCGTCAATGGGTTCCGCTGTTCAAGAAATATTTGATTACTATTTTTTTTACTTTTAAAACCAAAGTAATGTACATATAATACTTGGTTCAAAGGAATAATAAATATGTCTATAATCTAACTTATTAATGCTGGCGATTAATTCAAAGATTTATATAACCGCGAAATGCTAAAACTATGCGCAGATGAAAATTCTGTATCCACTGTTTGCTGTTTCTATGGTTCCGAATTGTATTTTGTACTCTCCATTGGTTGGTGATAAGAATTAACTGCCCCTACATAAAATTGATAGATAACCGAGTGCTCTGCAGACAAGCAGAAATTTCTTCTATTTACATTATTTATGGTACCAACTAGGCTGTTCGCATTTGAACTATATTAAAATCATTCTTGAAGTAATAGCTATTGGACTCATTGATTGGTCAATTAAAAGTAAAAAGCACCAATATTCATTCGTATGTCCGACTTAGTGTTTATATTTATTAGCAACTTTGCCTTCTGCATCCGGATACTTATGTTGATATCCGGATTACGCGAACATGTTGGAGAGACTGAGAATCATTACCTATGGTATCAATGTTTTGGGCGTCGTACCCAATAATATTTGTCTTTGTCTCTCTGCATTCAGCCC ATCGAAATGGCACCGGGAGTGCGGGGCGGGACCAATAATTTGTAGGTTAGTCTACGGGAGCAAGTTACATAAGAAGCGACTTGAAAGACAGTGGCCCACCACAACCCGTTCCAAAAAATGTGAGGAGGGAGATGATATGCACACTCACTGGACATACGAGTGCATGCATGCACATGTGTGCGTACGAATCGAACTGAATAGGTTACGCCGGTAGTATAAAGCATCTATCCGAGTACACATTTGCCAAATGGATACATACTGACAACCGTATACCATCTCGCACATACCGAGAGTCGCGCAAACAGAACCAAATTGTACGCCACGGTACGGAACCGAACAGAGCAAGATACAGATACAGAGCCGTAGGTTGACGAGCGGTGGAACCGAATCAGAATCCGAATTCGAATCCGAAAACCATCCGAACGAAATAAGCGCCAAACCTCAGCGAAACTCAACAAACGTTTTATTGATTCGACGCCAAAATGGAGCTGAAACTACGCTACTTATAAGAAAATGGCCCCAAGTTAGTTTGATATATAATGCGTGTATTCTGTATCTGTTTCTATGGCAAAGGCGGATTTTGCGTTTAGGTTTTTCGGACTTTCTTCGGCGTAAAGGGATTTTAGATTTGAATATTTTTACTTCCCCATTCAAGGGGCTTAATAAATCAACATATTTGGTCTTTAATCTGAATCGGCAGCTATGCAAAATTTAGTGTTTCAGTTGCCATAAATTTACATTATTTCGCGCTTGTGTGCTTTAATTTGCATAGTAATTAAAAGAATTACTCTCATTTTTATAATAGCTACTTTCGTCTCCTGGTTCTCTGGGAATCTCTTTAAGTATACACAAAAACCCAACCCACTGTAAAACCGCTTCAAGGAAGTATACCCGGTAGTAAACTTTAAATATGATTACTAACTAATATTAATCGTACTAGATACTCATTTTCGGGAACTTACATTTTATTAATACTTCTGGTGCCGGGGGCGGAGCCATGGGATTCGGGGGCTGCTGGTAGGCCTCCATGGGTTCGCTTTTGATATAGGGATAGCTGCCGGTCA


Search Again