CR01483

CRIMIC CR01483

Gene CG11929

CG11929

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATCATAGGGCAATAGGGTCAGGG

Amplicon 5' Amplicon 3'
ACGGGCACAGTCCCTAAATGCCGGCGATGGTTTTCCGGATAGCGTATGATGGGCCAGTGTATCCCGGTCGAAGATCTCGCAGAGCAGCTTCCTCGTGATCGAGGGTCCGGTCATGTCCCAGTTGATGGCACTTAGGCTAATGCGGGAAACTTCGGTGCCATTGGGACCGATCGTCACCATCGGCGATTCGCCGTCCAGGTCGAATTCGAAACCAGGACACCGCCGTTTCGCATTCGGAGTGGAGGTCACCGGTTTCTTGATACGCTTCCTCTTGTTACCCATTGTCTCTTCTCCGCCGGGCACATAGTCCTCATCGTCATCGTCCAAACCAAGATCTTCGTCGTTTGTTTTCGGCGTCGAGGTGTTGTGCTCATCGGCTCCATCGCGAAACGCGTTAAAAGGCTCCGAACTCTGCTCCTGATCCTGGTCCTGCTCATGAGACTGTTTGTGCTCTGGCTCCTGATCCATTTCCTGGACCTTTTCAATTTCGATGGTGAGGAGATCGAGAGCCTTGCGCTTACTGCGCTCCCATTGCTGGAGAAGCTTCAAACGCGCCTCATTTACCGCCTGGATGGTGTTCCTCATCAGCTGCGAGTACTCCACATCCTGCACCATGTCATCGAAATCCTGATCCGGTGAACGCTGTGTCCTTAGCAGCTTCTCAGCAGCCAGTGTAAGAGTTTCCAGAGTGCTCAGCTTGCCACTATCGGACATTTCGATGTGTCGCATGGCGGAATCGGCAAACTCATTTGCATCTTGAATGCGCCGCACCTTGCAGTCATCGCTCTCCTCCTCCGTAAAGGAGTCATCCGTTCGCAGGCGGGCGATGATCGCCTCCACTTTTTTCTGCGTTTCAGACAACTGAACTGTCTCGGGATCATAGGG GGCGAATTCCAAACGCTGACGGCGGTTAATCTACAAGGAAATGATTTTTTATTTTAAAATGCTTGGTATTTGCTTCTATTTAACTTACCATTGTGCTGCTTGTTGTCCACTTGCAAACTGAATTACTGCTAATAAGTCAACACCTTATATACCACCAATGCGAAAACCTTTACAGGTAGTTTCTTCCAAATACTGATTAATCCTTTTATTACCCTTTTTAATTTTGCAGATGCTTCCATGGCCGATTCGCTGCCCACCGGGGCGACTGCAACTCGCCTACCTGCCGGAGCAACTTGCAGCTGTCGTTCCATTTCGGGACGCCCGAAACCCGCTGCCATCGCCTCGGAATCAACCCAAACCATAGCTTCCACCGAGGACATGGGCACTCAAACCGTCTTCCAAACGGATCCCAATGAGGATTTCGATTGTGGCCAAGATGCATCCACCCAATCGATGCTTAATATGCATGATGTAGAGACTCAATCGATTCCAGTATCGTCCAAAAACCTTAACAGCATACAAACGCAAACGGACTATGAAGAACCAAAAACTGTCCGTTTTCCGTTGAAAAAATATTCGAAGACTGAGCATGAAGAAAAAAGACCTAGAAAATCGAATACTTCATTGCGCAAATGTTTTTTCAAGCGCCCATTAATCGTAGTCAAAGGCGGCGCTCTTATATCTTCCGATTTTACAGCCAATATCCATCAAAGTAGAATGGAGAACGTATCTGTCACTACCAGAAAAGAAGATAAAGAAACACAATATGAAAACCATTTTGGGACACAATCAAATAGTTCAGACGATCAGCCTTCAGATCCTTCAACGTGTTCAAAAATCCTCGATAGAGTTCAGAAACTGGAAGCCATAATGAAGAGACAGGAGCTTTTTCTAAGGGATCTACAGGGCTCTGTGAAATCGTGG


Search Again