CR01476

CRIMIC CR01476

Gene CG15705

CG15705

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK (weak)Order from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CCAAATGCATCAGAAATACGTGG

Amplicon 5' Amplicon 3'
GTACTTGGGAGTGGTGGAGCACCTGGTGGATGTGGTGGCCTACTGCATGTGCCGTGTCCTGGAGCTGTCCCTGTTCGCCTGCATGATGGTCTGCGGCTCCATGAGAGCCAAGCTGACCCACGGACCCACCAACGAGCTGGAGCAATGACCAGGACACCAGGAGTGCTGCTAAAAGGATGCGCGCGTTTGTGTGTTTGAGTGTGTTTCGACTAAAATTTAATAAAGGCAACTTTTCTAGTGGCGAATAAATTACAACTCATATGTGCTTGTAAACGATTGTCTTTTCCTCCCGTTGGCTGGCCCTTTGGAATTGAGCCATAACTCAAGATGGCCCACGGCAAGGATGTGGCCAAAGGGACTGGCTGTTTATCCTTCAGCTTCCATTGTTGGATTTTGTTTTTGTGCGGCGTACTCCGTTCATGGTACTTATTAGCCCTGAAGGGGATTATATGGGCAGTAATACAATGCCCATTTGCATGATGATAAAGTATCGACTGGGGGGGCCTTCCATGCCCACATGCTGGGCAATTGTGTGTTGGGGCTTTTGTTTTTGGCGCCTGCAAATATGCTCCTTTTTATTTGGGGAGTAGCCCCCATCCATTTCATAGGATAGTCCTGCTTCGGTATTTATGTAGTTGTTTACAGCCTCCGGCTTGGAACATAAATCCATTCAAATTGTACGTGCAAATGGGAGGACATCATGTTATATTACACACACCCGCAGCAGGCACTTCGAATTTGAGTTTTGAGCAAGTACAATTCATGTTTTGATACATTTTTGATAGCTGAGCAACAAAATCATACCAAATTCCCCTCTGAACATGGACAGCCCAGTAAAACAGCGCCTAAAACCCAAGAAGCTGGACAAACATCCAGGAACTCAGAAGGTCGAGTTCAAAAAGGATATCATCGATGAGGTAGCGGATCAGTCGGTTGAATACGATTACATGAAGTATCCCAGCAATAAAGAGAAGGCAAAACTCCTGAAAGGCGTTAAACCATCGAAAAGTGTCACATTCAAGACGGTGGTGGAGCTGGTGACCTATTCGGAAAACTGGAAGATGAAGATGAGCGAGAGCAGGCTGCGCTCGGAGGATGAGCAGGTGTGGTTACGGATGCTAAAGTCCACTTTCCGATACTCGGGCACCACG TGATGCATTTGGACAAGCCTATTAAAAATTTTAGTTTTACTAGAACAATTTAAATAAAATACTACTACTACTTTTTGATACGTTTTCCAATGCATCAGACTTATTCTTATTTTCAGTTTCTTATATTACAATCTAATCATTCTTTTAATCTTAAACTTTAGCTGAAGAGCTCCCAAAAATATCGCAACTACTGACAACTTTCCTTAAAATTATTGTTCGTTGTAAGCTAATAAATTGTTATGTGTTGATAAAAAAATATTTCGAGAAAAACTAAAAATAGTTGGTTTTTATTTTGGAAAAATAATGGTCACAGACAATTTAATGAGAGTTTTTTTTCCCCAATATCATATATTTTATGGCAGGATCTTTATTTACCCAATGCTCGGCATCGCAGCTGGTTGATGATGTTGCAAATGACATACTCGCCGGTATCCTGGCCACCGAACTCCTTGGTGCGAATGCCTTCGTCCATGGTGCGCTTCAGCTCGCACCACAGTGCATCGGCGCACTTATCGTGGCCCAGATGCTGGAAGAGATCCACAATGGTGGACACGATGCCGTATGCACTTAGATTGGCATAATTGGTCAGCGATAGTTTCGTCTGGAGCGGTTTGAAAACGGCATGGTGATCTCCGATCTCCACCGCACTGAAGAGATTAGCCCCGCCACAGACTCCACTGCAGATGGCGGATAGGAATGTGGCATAGCGTTCGCTGGCGAAGAGGCAATCGAAGTAGGTGGGCTCCGTCATCAGCCGGCTGATGGCCTCCTCCACCTCCATGAGCTCCAGCTCCAGGCAATCCTTGTAGTGGCAGTGCAAGCGCTGTGCGGCTTCCACCAGTGAGCCATCGCTAATGGGCCACTCCTTGGCCTTGTTGATCAGCGTCACCCGTTTCCGGCCCGCCTTTGCAGCCGCCTTAAAGGCGTACCGCAGATACTTGTCATTGCCTTTTTGGGAGACGACGGACAG


Search Again