CR01468

CRIMIC CR01468

Gene CG8192

CG8192

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGGAGCACTCCAGGCTGCGCTGG

Amplicon 5' Amplicon 3'
GGAGTTCGCTGCATGGAGATGCAACTGCGGCTGGGAAGGCAAGGAAAGCTGGGCGCTGGGAATCACTGATCAAGGCATACGCTTGTTATCCCAGCTAACCAATATCCGAAAACCAAAATAAAATGTTAACTTGGAAAACTGGCCTGGTATGGAAAGTTGAAGTGTGTTTTTGAAAAGATCAAATTCAATTCGGATGTCTTATCTAGGAACGTCACTTGACCATGAATTTCCAAAACTAGTAGACAATAATGAACTCCAGTTGTTCATTAGAACCAAGTCATTGCATTAATCATCATATTAAGAGAGTAAGTTAAAGAATATCACTAAGATATTTTTAGGCATGACTTTCTATTTGAAATAGAAAATGTGAGTAACTTATTTGATAGACTCTACTCTGTAAGCACTGGCTTACTGCTTGAATCTAATAGCTGATATACCCCGAGACCAGTGAGTATAAGGAGGATGCTTAGCTTGCGGCGGGTTCAATTTGAACGCCATTTACCCGAGACCCACTCGCTGACTCGACTTGGCTGAATGTCAACTGCTGTTCATACGCATGATATGTACCCCTGTCGCGGGGCGAATGGGATTGGAATTCCTGGCCTGGAAACCAATGGTACGATCCGGCGGTGGTGCTGGCCAGTCCAATTAACCAATGTTACGTGCCTGCATCTAATTGGGGCCATAACGTCAAAGCCCGAGTAAGAGTTGCAAATAGTTGGGCAAGGTGAAATATGCGAGAGAATTGTAATAAAAGCAATAGCAAAAGCAAAAGTCGGTCCGGACTTTTACTTTTCACGCCAAACGAGTGTCCGGCTGCTAGTGACTTTGAACCCGAGTATGCGGTGGACTCCATTGATTTGGGCCAGGCCAATAAATCTGGAGAGCGTCTTATGCAAGTATCGAAATTTCCAGCTGGCAATTTGTCAGCCAGTCGCTTGGCAGCTGCGAGTTGCTAGTTGCAAGTTGGAAGTTGCACCTTTGAACTTTAGGAGCTGGCTGAGAGTGCCACTGTTGCCTGTTGCATTGTCACTGTCAGCGAACCTTTTTGCGCAACCTCCATGGGAATCCGGGGGAATCTGCCCCAAGGAATTGGCTTCAGCGCCAGCGCCACCTCCACCCCAATCCCAATTTCAATCCCGCCTGCAACACATGCAAATAGCTGTGCACATTCCAGCG CTCCACTTGCGGCACACAAGCACCACTTTCGCAGTCGCAATGGCCAGAGTGTCTGCCATAAATGGGGAATTGGTTGCATGTGTCGGGATCTGTCTCTGCTTTTGGTCCAGATGCAGACGTTATCGCACTGCAGTTACATCATGCATATATAGCTAAAGCATAGAGCACAAAGCATATAGCATATGGCAGTGGAGCAGCCATGGAGGCGATGCGTTGATGTTGATGTTGATGGTTTTCGTCGACCCCAATCCCCTGGCCCGATTTGGACCCACTTCTGGAAACCACAAGACAGGCTGAGCCGTCGGTTTCGTTATACATTTTAGCTGAGTTAGCTGTGAGTTGGTTTTTCTCTGTGTGCCACTGGGGTTTCTTGCGTATGGAACTCGGACTATATTTGCTTTTGATTTCCTTAAATGTTGGGTGTGCGTCATGTTAGGCGGACATTTTTGGGGTGACATAAGCGCCGGTCTAAGATTACGACATTTGGCAACCACCTGCATTTCGATAAGTGTGCTGGTTTTTCGGGAAAACGAGAGTGTAAATTTCTTGTATAACTCATATAACGAACGCATTTTCCCCGGGAGTTGGCAGAGAATTAAGAGCTAAGCCCACTTAGTGCCACAATCGCTTGGGCTGCCCGCTGTTTTTCCTTCATTACAATTTCAATTTCCATTTCTCGACTCTTTAGCGTGTAATCGGTTCGAGTTTGTTGCCTAAGTCTTTTGTTTTCACTTGCTGTAGTTGGTTTATTCGAGTGCTTAATTAAACACTGGCTCGTTAACACAACTCCCGATGCCATTAAACTGTGTGAAACATGAAAACCCAAAAAAATAAACTACATTGCACTGCTTTAATTTTTTCCTTTTTTTTCACTTTTATCCATTATTTTGTTTTTTTGCTTGATACAAATTAAGAGCTGTTAATGTGCGTGCAGT


Search Again