CR01463

CRIMIC CR01463

Gene CG4409

CG4409

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 long band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATACGCGTAGCCGTAGGAGTGGG

Amplicon 5' Amplicon 3'
CCTCGGTCATGAATTCCCCCAAACAAGTGAGTGTTTTTGTTGAACGTTACTGATTAAATTAAATAATCGCTCGGACAAAACGATTGTCAGAGTCTGGAATGGTCTCCAAAGTCTCCACAAAACTGCGGGCGAAAAAGTACCGTGAGAAGAGACTGTCAGAAGTTCAGAATCGGTACAGAAGCTCACATCGCCAGTATGAATCGCGGCCAGCTTTTAGTTTTGTGCATTTTTGCCACTGGAATTTCCCTTTCGATGGGTTTTCCCCAGGACGATCTAATTAAGCCGGGTAGTGACGAATCGGATGTGAGTGGCATTGGCTTCGTGACGCTCGACGGAACGGCCAGCGAAGAGAGTGACGAAAGCGACCAAGGCAACGCGTCCGATGATTTGATATTTTTGAGTCGCCAAAAGCCAAGTCCGGTCAACAATTCCGTCGATTTGAGCGCCTTTGTGGCACTGATTCCTCTGCAAGAAGTCCAGTCCATTGCTGCTCACTATTATCATCATGATGCGGAGTTTCAAAGGTCGTACGCCTTTCTCGCCAGCAGCGATTTCGCGGACATCAAGCGGAAAATACTTCAGCTGCCGGAAGTGCTGGAGTTCACCAACTATCTGGGTAACAATGGACTAGATGTCGTCAAGGTGATGCATTCGGTGGCAGGAGTGTTCAAACCGTCCATTCTGAGCTCCGCAGCGGTCAACGGTGCGTATGAGTAATGATTTTTGTCTTAGTAAAGATTTCCTTTAATTATTGGTATTTATATCCATAAAATCCACAAAATAGAAAGTGAATATTAAATAAGCATTTATTTATTGTCTGAAATCTACTGAGAACTATTTCTGCATTTTTCAGAGCCAACAAAAGTCACAACCACCGAAGATGGCAGCTCCGCCGCTGGAGAAGCACAAACTGGCCTCCATGGAATGGTGGAGAGGGTCCTGGAAATTCTGCCGCAGGACCAACTGTACGCCCTATTCTTCGACGAGTTTGAGAGCAACAAACAGTTCGCAGCATTTGTCGACAGCATTAGCAGTCCAAAGTTTGCCAAGATTTTGAGCGGTTTGCAGGTGAGCTGGGAAATCCCGGGTCCACCATGTGGTAATTGTATTTCAGCCAGGGGACACGCTTTGT GCTACGCGTATGTTTGGGGAAAATTGTTTAAAGGAATTCCATTCGATTGCCAGCTCCATAATAATTTCCAAGAGGGACGTGAGAAAAATTCCCGATTGCTTTATTGAGTTTTGGCCAAAAAGGTATAGGTTAAAAGTGGGCAACCTTTATATGCGATTCCGTATACAAATCAACTTCCGTTGATGCCTACGAATTTTCAAGTGCCACCGCCTTTTTCTTTTTATGCTTTTTTTTCGGCCACATTTCCCAGTGTTTTTCGTTTCGCCTCGCTTCTAATTGGCAATTGAGCTGGCCTACGTGAGGCACATATTTATGAAATCAAATCGACAGCCAGCAGGCAATTTATATTTATTTTTCCCAGCCCCATAACCATATATATTTATCAGCCATTCCGATGGAGAGTGTTTCTGATAATTGATTTCGCCGCACTGATTCACGTCTCATTTTCATCATTTCAGAACTCAATGCCGTTGCGAAATCTACTATTTGTCCTGCACAATAACAGTATCTATGTGGAGCGGATTGTGGAGTCCGTAAAATCGTATCTATCCATTTCCAGTTTTTAGTTTGCCTAAGTCTTAGGGGCTTGTTTTAAGCTCGCTGTGGCAAATAAACTGTATGAATTAGACAAACTTATTCAAGTATATGACCTTTATATCATTTCATCCTAATTTTGTTGACTAACAATTTGGTAAGTATGTTATCACTGAGTGTTCTGTTTATCTGCCACTTTTTGCCCACCACGAGCATATGAAATTGGGCTCCCCATTTAGTGTGTAATAAACGGAAGGGGAATTCTTTAAAGACATTCGTTTGTCCTGTTGGGTGGGAAATCGATGGG


Search Again