CR01461

CRIMIC CR01461

Gene CG17544

CG17544

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AAGCTGTCACGTAAGACTGCTGG

Amplicon 5' Amplicon 3'
TGGGTGGTCGGATCATAGGTGGCCGTTGTCCGGATGCTCTTCGTGTTGCTGCCATGCGATAGCTCCGTGATGGCCAGGCAGGTGATAACCTCCCGATTCCAGGCTGCCTCAATATATTTCTGGTGCTTCTCGGTTCCCATGGCACGAATGGCATTGTTAAACAGGCCCACGCCTAGGGCTATCTTCACCGACAAACTGGGCGAGTAGCAGGCGAGCGCCTCGTTGATGTACATCAGATACTTTGTTTTGGCCGAGAAGCTCAGGCTCTCGATCTCCTTGGGCACCAGGTCCAAGTGCTTCATGCGATTCACCTGCATGGCGCACAGGCGCTTCTGCTCGTCCATGGGCAGTGTGCGGGATGGGTGGGCAAAAAGGGGGTCATTCTCCAGGCGACGCCACACTTTGTACTACGAAAAAGGGGACATATTAAATAGGAATTCTTTTAAGAATTTAATAACAGGAGTAAGTGTGGTAACATTCTTAGATTCAGTTATATATTTGTTATACATATGTACGCAAAATTACTGAAGGTAAGGTAATATATCAAGTATCCTAATTATTCAACAAACTTCATAACATAACTCACATGCATAACTAATTATGCTATTTGAAATTCATTATGTATAAAAATTATTTTGAAAACTATAATCCAAAATAAAAGTTTGTTTTATAACGGAAAATAAAAGTGAACATTTTATTTAGCGTGTTTTTAACGCTTTATAAACTATAATAAACTAAGATTTTAATGGAAGTCGCAAATCGTACGTAACAACTACTTATTGGATAATGCCATCAATTTACTTTCGAGACTCTAAAGACATTAGCCATAATTCAGCGATTTGATAAGCTGTCACGTAA TGGAAGATATTCCAGCACGTTCTCTTTCTAAGAGATAGCCATCCACTTACCTTAATTCGCAATCCCTGCTCCTTCTCGAATATCAGTCGCAATCGCTTCCAGTCGAAGTTGGCCCTCTTCCTGTAAACGGCCAATGGTCCACCGCTGGGAAGATCGGGAATAAAGCTTGTGTCCTCGCTGCCCATTGTGTGATTTTGTTTGATTTGATTTCTTGAAGAAGAAAGGAAATGGCAATGTTATCGGATCAGTGGAGCTGCTTATAACCAAGAGGCTATAGAACGACTGCGATCTTAGCCAAACGCTTAAATGGCCCAAACCAACCAGTTGTCTAGTCAGTCAACAAGTGGGGCACTCGAACTGTTTTATCTACAAGCGTGCAAACGACTGAAGCCGTAGAAAGGAAAACCCTCAAGAGGTGCTGGTTTTGAAGCCATTGTTGGCCAGCAAAACAGTTTAGCATTCACTGTTCTCAACTAACTATCATCTTATGCACAAAGAGAAGTTTCAAACCAATGGGAATAGGCTTAGTAAAGTTCTGCGCCCAAAATGAGAACAGAATATAACAGAATAATTGGTTTTAAAACTTTATGTTCTATTGAATTTTGTTCTAAATATATGGATACATTAATTGCTAAGCTACATTAGTTATTAGCAGCAATTCTTACAAAAGATTACTTAGTCGTCATAAGTAAACTATTAAATATACTTCAAAGCATAACTGCCACAAAACTAAATTGAAAATTTATACATTTAATGCATCACTTTTAACCTGATCCAAGGTCATGTCCTTGCAGTGGCAAAATGAGGTGGTGCGGATTACGCGCCAAGTGAAGCGCAATCTACCGCACCGAAATTTCCGAGAGATTAACTTTGATCGCGAGACCATAAGGCA


Search Again