CR01440

CRIMIC CR01440

Gene CG5335

CG5335

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GACTAATTACTTGTCAAATTGGG

Amplicon 5' Amplicon 3'
CGTCGCTATCGGACATGTCAAATTCTTCATCATCAAAATCGATAATCTGTGCAAAAATATGAATAATTTTTAAATATCTCCATTAGATTAAACACAGGAAACAAACAAACCTCGCTGTTTAACCGCTTGAATTCGGAGATTCCCGTCAAATCCTCCAGAAACTTGGCTGTTTCAAAAGTTTTAAACAGGAAAGCATGACCCTCTTTTTTATATTCATTTAGGACGGCCTGTAAGCGAATATATTAAAAAAAAAATTTTAACAATATTGAAAACGCTATCAAAACCATTTTAAAAGATTGTCAAATCTTACCGCTGAACAGGCTATGCACTGAGCAAACTTTTGAGTGGCGGGCAGAATATTCTCGTAGTTGCACAGCATTCCACGGATGGAGTGAGGCAAAATTCCTAGCAGACCCTCCGGCACCTTTTCTTCCGTCTCCTCCGACCTGCCACGCCCACTCTGTGCATAGTAGGCGGGTGCCAGCTCCTTACGAGGATGCTGCAGCAAAGCCACCAACAATTCCACCGCATAGCTGGCCGCAATGTTGGATACTCCGGGTCGTGTCACTGTGCACTGTTGATCCAAAGTTCGGTCTTTGAGCGACTGAAAATGGAATAGAACGAAATGCAATGAGTATCTGTATCCAAATTTGTACGTACAACTTTATAAAGCGAGTCTATAAGAGATTTTTTTATACAGAGTTTTTTTCAGTGTGATTTGGAGCACATTCGACGCCGGTGCAGTAGTACGATCAAGAGCTTTTGAAAGCTTTTCTGTGTCCACAAACACATGCTCCGAGCAAACAAAGATGACGCCTTCGGGCGAGAACAAAACAAATAGCAGCGCTTAAAAACCAAAAACACAAGATATAGAAAACTTCGGCGTTTGTATCGGTTACTTGAGCAACCCGCCGCTCCGCCCATCACTGATTAGATAAAGTTTTAACATTTGGGAGAGCCGGAGAACTCCGGACTCTCCCACGGAACTATAAAACACATTTTGCGCTTGATTGTTCAGTACAAAGGCGATAGTTAGTTGAATTGGTAATTGCAGGAAGGAATCATGTTGACCGAATTCGCTGGCAATCTATCGCATCCGCTGGAGTTTGGTCATGTTCTGGAGGTCGTGGCCAAGACCATCGATGGAGCAGCCAGGTAAGTGTTGTCCGGCATTAATGTAAGACCGCTTTTCCGTTTTC TGGGCTTCTTATCAGTACGTGACTAATCGATTGTGATCATTTGGTTCGGATAGGTTCCACATTAACCTCTGCACGGCCAAGAGCACGGTCGATCCGAACGCAGATATTGGGCTACGCTTCTCATGCTATTTTCGGAACGATGTGATCGTTCGAAATTCCCGGATAAACGGCGCCTGGGGCGAGGAGGAGTCCCATGTCATGGACCCCAACACCCTGCCCAATCCCATCGTCAGTGGCGAGTTCTTTTTGGTCTACATTCTTTGTTGCGAGGACAGCTTTGCCATCTCGATAAATAGCCGAGAGTTCTGCAGATTCCGCTACCGCATGCCGTTGGGAACGATTCGTGCTCTGGAGATCCGTGATCAGATCCAAGTCATTAAACAGGTGGATCATCGTACTGTGTTTCCAAATCCGTGGCCAGCCGTTCACGCCTCGGACTACTTTAAGGCGTTCAGTAACGATCAGCCAATTTTGTTTAGTCCGGGCCATGTGATTGTCCTTACAGCTCGGTGTTTCGAGAATAAAAAGGGACAGTTCATAATCAAGTTCATGGACTCGGATACCAAGCGCGAAGAGCTACACTTCAGTGTGCGTTTCGATGAGAAGGCAGTAGTGCGCAATTCCATGAACAAAAATTTTGAGTAAGTTAACTTTATAATGCCGTACCTCTTTGGGCGTTAACTAATTCTTTTTATAGATTCGGAAGCGAGGAGCGTCATGGAGGTTTCCCCTTCGTCTTTAACCAGCAATTCAAGCTGGCGCTTGCGTTTACGGAACGCGAGGTTTTGACTGCAGTGGACGGTTATAACTTCTTCAGCTACACCTGGCGCACACCTAATGCCATGATGAATCTAGTGGGTTTCAAGGTGACCAGCATAAATGGCCTGGTAGTGCAGATAACTGGTGTGGATCACCTGCAGACGGGGGATCCTACGTGCGCTGGCTTCGAAAAATATTCCCGCCATGATTACGAATGCGTTTAGTAACCATGTTAACCCAACTAATGAAGTCTGAAAATACAAATGTTATCTTAAACTATACAACAAATGGGACTTACATTTCCAGGGGCCG


Search Again