CR01434

CRIMIC CR01434

Gene CG14752

CG14752

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACTGATTAGCTAACAGGCGATGG

Amplicon 5' Amplicon 3'
TTTTCGCTTGGCCGTTGAAGTTGCTGCTGCTGTTGTTGCTGCTGCTGCTGCTGCTGTTGTTGCTGCACCGACGTCACGTCTTTCTCGTGCAGCGCAGTCGGCTTGCAGCAACAACACAAAGCGCTGCTGGCGCCCGGTATAAAACGGATGAGTCGCAGCCTGTGGTTATCAGTCACCACCTGACAGTGCTCCGGTTTTAGTATCGCCTTTCGAGTGCAGCAGAGCTCAGCCCAGCCACCATGTCCGTCCTGAAAGTATTCGTAAGTGCGACAAGGATAACGTTCGAAAAAGTGTTAAGCCAAACCTCCGCGGAATGGAGCTGAAAAGGATTAAACTCATGTGGACTATCGTGAATAAAACTAACCAACTGAAACATAACAAACTCACTGAAAACTGACTTCGATAACCGAAGTATTGGAAATATACCACCAAGATCGCCTGATGGCTTAAAAAGTCTCGAATAGATATTTCAAGAAACTGCGAAAGCATTTATTTTGCAGAAATATAAATTCACCCAAAAATATTAGTTTATGTTTATCAATCGCGGACTAACATTTCATTAGATTACTTAGATTTCACCAGAATTGAACATAAATTTTGAAGTGCCAAATTAAAACTAATCACACTGATTAGTTAGCTATTTGCGTTAATCTAGCCGGACCTAACTTACTAACTTCCTTATCCCCTTTCAGATCTTCGTCGCCCTCTTCGCCGTGGCCTACTGCGCACCCAGTCCCGGCTTCTTTGGCAAACAGTGAGTATCGGCGGCGATCTGCACCTGAACTGATCCATAAATAACCCGAGCGAATCGATAAAAATACCCATTTCCCGCTTTATGCTAAGCTAACGAGCGGTCGCATGGCTTTTTAAACGCTGCGACTGCTCCGTGGGTCTATGAAATATGTGTCCGATTGCGATCGAATTGAGCAATCAAAACGCTTGTAGCACTTAGAGCCCCAGCCCCCTCCAGCAGTCTCTATATGGTGCCCACCACTGGCTACCATTGAACTTAGCCGATCTCGACTTGGCTTGGCTCGCGGCTTAGGAATTTCGCAGGCGGCGGTTGGCATTTAATTCAGCGTAATGCGCGCATAATTGTGCGAATCAATTGCCAATTGCCAATAGCCAATATGCAATAGCCATGTCTGCCAAGACGCTGGGTTCAAGCA GGTACATGGCATTCGATCTAACCGATTTCACTTTCGATCCGCAGCGAGCACCACACCATCCACGTGCCCTACAAGGTGCACACGGTGCACCACCATCACGTTCAGAAGGTCCATGTGCCGGTGGTGAAGCACGTGCCGGTGCCCATTTACAAGGAGGTGCCCGTGCACCACGTCCACCACGAGGAGATCCCCGTGCCGGTGCACCACGTCCATCACGAGGAGATCCCGGTGCACCATGTCTTCGATGACCACCACGACCACCACGGCTGGAGCTCCCACCACGGACACGGCTGGCTGTAAGCCATCTGCCCGCTGGCCTGCTTGTCTTCAAACCCACCCACTCAGCCAGTCCCATCTGAAGCAGCCTGTAAATACTGTACAATGCTAAGTTAATGAATGTAAATAAATCACAATTCGACTGTACACAGAACAATCCTGGCGTATTTATGGCAGGATTCCCTGAAGTGGAACCTTAGTGTTTGATGGCTCACAAGTAATCTAATAAACCAAATACTTTTAATGGGAATGAAATAACGATTTTGTTATTTGAGGCTTTTTAAGTTGTTGCGATTAGGATAGATGGTTACTTTTGAAGACTCGAAACTTGCTTATCTCTATATTTATATACTATATAAGATGGTAGAATATAACCTACTTGTTAAGTAATATTTTTCAAAAGATTTTTGTTATCAGTGACAGAACTTGTACACATAAAATAAAAACCCCATATACTCAGATACTCAAATACTAATACCCTGATAGCAAATAGCCACAAATAGACACACTACCACATTTGCACCATGATATATCTACAGAGTTGCTGCTGCTGCGTGGATCTGCGAATCGGAACCATAGCAATAGGGATTTTGCACATTATAGCGGATATCCTTGGAGGCACATTTGTTGCTTTATTTGGGGAGTCGGGTAAGTGAAGC


Search Again