CR01427

CRIMIC CR01427

Gene ACXA

CG17176

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGAATCCCTTTCTGCCGATGTGG

Amplicon 5' Amplicon 3'
GTCACGGGCCTACTAAGCATAAATTTCTTTGAAGACTTTGTAATCCGCCACAGATGGGTCATGACTTTCACCTCGACTTTGTCGGCATATGTTGTGGTATTGGGTGGTAAGTTTAAGAAGTTAAATATGCCCTTATATTATAGTTACACCAGCTACTTGTAGAGTGTTTGTACTAGATTCAATGATAATTAGTCGATCCTTAAAATCCACAACTTCTTTCCATATACACTCAACTATAGTGTTTTCTCTTGTTTTCAGATATAGCCTTTAACACTTATTATTATTACAAATCCAACTGGCCTCTTAATACCTTATACGATGTCTTTGTGCTCTGCATGATCTACATGTTCCTGCCAATACCTTCGAGCAAGGCAGCAGCTCTGCTAGCCATATCTGTTAGTTTAACATATGTGATATATTTTATTCACTTCATGGCGTTTAACGAGCATAATGTTGCTAAATATGTTCATGGTCTGGATATAGTATCAATCGATTTTTTTCACTACCTGGGCTTCAATATGATGGGAATATTCTTCAGAATCATGAACGACACCATGGTGCGCTCGTCGTTCTTGGACCGATACCAGTTCATTACGGAGGAGATTTGGCTACGCCAAGCTCGCCGTCAAGAATCCTTGCTGCTGGATAGCATACTTCCACCACAGATTGCGAAGCCCATTCAGAAAAGCATTAAGGAAAAGATCATACAGCCCGATAACGACTTCTACCATCTGGGCACTTCGCGGACAGCAGAAAACTTCATGTCCATCCAGATTCACAACGATGTCAGTATCCTTTATGCTGATCTGGTGAACTACACCCAATTGACCACAACATTGACGGTGGAGAAGCTGGTGAAGGTCCTGCACGACCTCTACGCCAGATTTGATTTGGCTGCCTTATCTTTCAAGGTGCAGCGCATCAAGTTCCTTGGCGATTGCTACTACTGTGTGGCGGGTTTGGGGGAATCTGATCCTGATCACGCCACCATGGCTGTGTCTCTGGGAATTTCCATGATTGCTAACATTAAGGAGGTGAGGTATGTTGATTACTATGATCCCATTAGGTTTAGAATCTATGATTTATGGCGTCCCACAT CGGCAGAAAGGGATTCGTTTTTTTTTTAGTTATTTTGCTCTAATTTGGCTTTCATTTTGAGTACCATTTCGTCCGCAGTGTGAATCGTTCTTTGAATATTGGCATGCGAATTGGTGTCCATTCGGGAACTTTGTTTGCAGGTGTAATCGGCAAGGCCAAGCTACAGTACGACATATGGGGTATGGTACGATGCAACAAATCAATGACACAAAACATATTCGTGAGTTTTCCAGGTGCCGACGTGAATATTGCCAGTCGTCTGGAAGCAACCGGAAGTCCCGGGTATGTGCATGTTAGTGGACGAACTCTGAGCAGCTTGAACGCTGAGGAATACAATATATATCCGGGCACGGAATCGGCCCAGAAGGATCCCGTACTGCAGAAACATCCGATGAGCACCTACCTCCTCACCGCTATACCATCCCTCGATTCGGATAAAACAATTAGCATAGTTGAGGGCGTTCCTAACCTGGACCTTCAAACCGTGGGATCTAACCGAAAATCACAGATTTTGAAGCCTAACTTACTGTCCCATGAGATGCGTGAGGAATTTAGAAAGATGCCGGTGGGGGGTTTCAAGTGAGTTGTGGGGAAAACTGTGCATTGTGCACCTGCAATGAAATAACGAACTACTACCGCAGATTTCAATTCCCTTGGTCGCGAAGAGAAAGAAATTTGAAAAACGAGAAAGTCGAACGCGATTTGGGCATTTTTTGTGTCGCATTTAAGGACAAATCTGTGGAATGGAATTATTTGCATCAGCCCGATTATATTTTTAAATATTCAGTGGCGCTCGGCTGGGGAATTGGTTGCTGTCTTATTTATATCCAGTCCGTGAACAACTCAGATATCTTTTATACGGGTGTTGTCATTAACATTATCGCGTTTTTCGTCCTGACTTTCCTACTATTCATTTGCTGGTACAAGAAAGTGTGCTGGTGGCATAGTGGACAAAACGAGCACAGGAGTTACGGCAAA


Search Again