CR01418

CRIMIC CR01418

Gene FoxK

CG11799

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTCCGTAATCAATTTAAAACGG

Amplicon 5' Amplicon 3'
GAAGACAGGAAAGAGTTCATATATATATATATATGATGCAATGCCTCTGACAAACGATTGTCACTTACCCATGTGACTGGGCGAGACTGGCGCCGAGCGGGGCATACCGTATGGAGGCCGGAAGCCCTGGCTGCTTCGCTGGCGACGCTTCTTGTAGCTATGGTCGATCAGCTTGGCACCGCTGTCCGGATCAATACGCCAGAAGGAACCCTTTCCGGGCTCGTCCTGGGAGCGGGCCACCTTGATGAAATACCTGCAGAAAGTCGATTGTGTAATTGAAACAATTTCTACTATCACTCCCAGCATCGATCAACATTACCTATTCAAACTGAGATTATGACGTATGGAATTCTGCCAGCCCTTGTTCGTCTCCTTGCGGTAATACGGGTAATGCTTGACTATAAACGAATAAATGCCCGAGAGCGTTAGCTGCTTGTCCGGTGCGGCAGATATGGCCTGAACGATGAGCTGGGCATAGCTATACGGCGGCTTCTCGTTGTGATTGTAGCTGGCTGTGGAGGGAGTCTGGAACAGATCCTGCTGCAAATGTTCATTGTTTGTTAGTATGCATATAGTTTATGGCGATCTCTAAAGTGGTTCACTTACTGTATTGTTGTTACCGTAGTTATTGTAATTATTGGGCTGATTCTGAATGAAACCCTGACGTGGACTAGCCGGACAACTGTTGGCAGCGCTTATTGTACCTGCGATGACAATTAAACAATTTCATTAGAATTAGAAAATTCGGTTTTATAACAGTTTAATAAATCTCCGTAATCAATTT AAACGGCTGAATGTGGTCCGCATTTAAGGATTCAAATGTTATATAGAATGAAATTCCACTTGCCAGTTGGTGATAGGTAGGGGCTCTTCTGCTCCTTCTTGGGTATGGATATTTTGAGCGGTGAATATATGCCGGGTCCATCGCCGGCAATTAGGTGGGCAGCTGCTCCAGCTGGAGGGGCCACAACGATGCTGCCACTACGCTGTTGCTGCTGGTGCAGTGCTGTGTGGTGGAGCGGGTGGTGTGGTGTGTGCGGGAGCGGGTGGTGCGCCGGTTGTTGCTGCTGCTGCTGCTGCTGCAACGGCAGGTGGTGCGCTGGCGGGTGGTGTGGATGCTGCTGTTGCTGCAGATGCGGCTGTTGCTGGTGGTGATGCAATTGCTGCTGGTGAAGTTCGTCCCTCGGTAGCGGTGTAATAATAACGTGCGCTCCACCACCAGCTACTCCACCACCACCACCAACGACTAACGATGGCGAATGACCGTCAATTGCATCCGATGAAGTGGCGGGCACATAGCTCTCGAACTCGATACGAATCTCCGTGCTCGGGAAGCGGAAGTAGCAGCTGCAATATGAATATGGGGCATTGCATTAGAGATAAGTGTGCATAAAATGGTATATTGGAAAGAATTCTTTAGTCAAACAATAAGTTAATATTAATGTTCATATTGCTTCGCGATTCCCTTGGTGGTATACCTACCGCTGCGGCAAACGAAGTGGATCCACATTGCGGCGCTGCAGGAAATCATCCACAAAGATGCCATTCTTGCTTAGGCACTGGACAAAGAAGGCTCGCAGCTCCACATCGTAGAGCACCTGAAAGTGTTTGCGCGACACAAGGTTGTTCTCGGCAACGTTGAAGTGA


Search Again