CR01414

CRIMIC CR01414

Gene CG8180

CG8180

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGAGAAGTTCTCCCAAGTCTGGG

Amplicon 5' Amplicon 3'
CTGTCGCTGTCTCTAACGCTATCTCTTTTCGTTTCTGTGCCTCTCTATCTGGCCTTGCTGCTTTCCCGTTCTCCAGCTTTCTTCTCCCGCTTTTCACGGCACCACCTCCCCCACTTCTCATCCCCACCAAAGTGCGGCCGACTTTGGACAGCGCGCTACATTTCCCGTTGGCCAATTTTCCTAATAGGTCAAGCGAATGTGTCATCATGTTGCTGTTGCTGCTGCTGCCGCTGCTCTTGGCCACTATCGTTGTTGTCGTTGTAATTTGTCTGTTTGCACAGCTAAAGAACGACAAAATAAATAAATTGTACAATAAACAAGAACTCTGGCAACTCAAATGGCCAAGGAACTGGTCATTTGTTGCTGCAGCTGCTGCATGTTGCTGCTGCTTCTGCTGCTGCTGCTGTTGCGTGCAACACATTGGCAGACCTAACGGCAACTGTTGCTGCTTAACTGGCCAAGCAGTCAGCGGAATGGCGGCGGGTCGAGGCGGAAGCCAGTTGAACATGACTTCTAATGGCCACATACATAAATCAAAGCCCCATTTTCAGTACTTGGCAGATAAAACAGTATTGAAAATGTTGAAAGAAAAAATGCACAAACGCCCGAAATTGCCATTGCTACTCTAGCTGAGTGCCAGCTATTTTTCCTATCACTCTGTTTTTTGTGTTTTTTTTTTTATGAACAATTTGCATTTTAATTAAGCGATGGCAGATGCTTTATCGCTGCCGCTCTGGCAAAAAGTGTGAATTGGAATTGTAAAATGGGTGGGTGGGTGGTCGTGGCGCAGTGCCACCTAATTGAACCCAGATGACTTTTTCGAGTCGCGCAGCAGGCAGCTTCTATCCACAGCAGCCATATAAGCCCA TCAATCCACAGATGGCTGCTGGCAACATATGTTAATTCTACTTGATATTCACAACAGCAACGGCAAAACAGAACTGGAAACCAGTTTGCAAACATGTACATGGCTAAATATACATATGAATGTTTATGACTGGATAAATAACGCTCGGCGGCTTGTTGTGCTAGCCAAAAAAAGTTCGAATAGAGTAAACACTACTCCAGATCAAGATTCGGTGTTAGATTTCGATTTAGATTCTGGGGAGAAACTCGTGTCTGGGCACTGCACAAAAATAATGTCGCCCATGATTCTCATGAATTGGTAAGTGAGAACATGTTTAGGCTTTTGTCGCATTTAAACATAATATAAAAGGGAAGGATATTAATATGTATGTAAACACTGAACGTTCGATTATGGTCAAGTTGGCTACGATATGGAATTACTGTGCTTAATTTTTGGTTTCTATCTCGCTCTAAATTATGTATGTTTATATGTTTGATCTTAGATCCCATTTCAGCTGATCCAGTTTCGCACTGATGCAAACTTTCCAGTTGAAGAGGTCAATGGAACACTGGCCCTGGCTGGGTTCTCTGTGAGAATCATCAACCATTAACATTTAAGTTAACCCCTTGTTGCAACGCCGACGATCCAGACTTGTAGTTTGCCAATCTGCCTCTTTGTTCGAGCCTTAACTGTATTTCAATGACAATGAGGTCGTCTGGCGGTTGGGTTGCGTTTTCTTATTTTCCGTTCTCTGCATTGTGTTTTTTTTCAGTTTTCTGTTTCTGTTTCAAGTTTCACTAAAAATAAATTGTATTTTCTTTTATTTGCATTACATTGTTTTTTAACTTTTAATTTCATGCCGTAAAACTTCCGCGTGATATATGTACGCCTTCTAGACGCGTTTCTTTTTTTTTTATTATTGCAATCCGTGCCGAAAATGATTCACGAAACTTCACGCTTATCAGTAGGCTTTGGTGACTAGCAATCGAAATTGGCCTTTCGGCTAAAATTAAAGCCAAATCATTTTCGAAGCCATGTGCACG


Search Again