CR01402

CRIMIC CR01402

Gene nahoda

CG12781

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTGCCTAACCGATGCTCGCTGG

Amplicon 5' Amplicon 3'
AGTGCAGAGTGTACAACCCGTTGGGCGACATTTTTGTGCGCAGCACTTTTGCCCATATTTTTGTTTTCATTTTCAATTTCGTTTGCAGTTTCATTTCGCTTTGTTTTGCCCGCTTTTTTAATTATATATACGCGCGCACATTGCGTATACGCAACGTGGGCAACGGCGGCACGTTTAACCCATTTTGGGGCATGACAACTTTTGCCTTCGCCTGCGGCTGCTGTTCGCTGATTTCTGTTTGCTGCAGCTTGCCAAACGCGTCTCGAGCTGGCCAAAAAGCAGGTCTTAGCCATGGCAACTGCAACTGCAACTGCGGTTTGGGCCGCTCCAGCTCACTGGCCGCCTTGATGATGATGATGTATGCGCCGACGAGAGGCAAAGTGGAATGCAACATGCTGCAAGTGAAAAACTTTCACTTGTGCATTACGGCACACAGAAGTCGCCGGGGGCAGAGCGTGTTGATTGGCGAGTGGCGACTTATTCCGGCCACCATCCACGATTACGAAATGACGAAAATGTTGACAACTACATCGATGATGGTAAATAGAATAACTTCAATAATGAAGGATCAGCAAACATATTTGCAATTTAACTTACTGTAACAGTAAATACCTAAAGCTGGATATATCCAAAATACAACTGCTTAAAACCTAGTCTATCGAGTTCCACGATCTATCTGCAGATAGGTCGCTGTATACAGTTGTATCTGCAACCGACAGTGACAACCAAATGAGGCTGAGGTTGTTTTGCTGCTGCTGCCCTTTCTATCACCATCATCATCGGCGACTTGCAACTGGTTCACTGGCCTACAAAAACGCAGGGATTGGAATGGGGACCAACTGACTGACTGCTGACCTCTGCGCATCGTCTTGCATCTTGTTTGCATTGCGCTGGCCCCTCTCGAATCCATTCCAGCCTCTCAAATCTAATCCATCTCAATTTGTTCGTGTTTGACACTCTTTTCCACAGCCTTTGTCTCAGTGTCTGCTGGCACACGATTTGTTTTGATTTGGCTTTGTTTTCATGTTTCTTTTTTCATGGCTTGTAATTGTCTGCTGGCGTGCTGAGTGCTCTGGAATGGAGGTCAAGTTGTGGTCGCCTCTTGTGTCACATGTCGGC TCGGTTAGGCAATACGGCAATCCAGCCATCCAATGGAGTTGACATCCACATCGGTTCCGATAATTAGAAGAGCAATCAACTCAATGCAAATGTCAATTAGTCAGCCGCAATCGCAGCAACCGCAGCCACCGACTTGAGCAACATTCAATAAGCTACGAAAGAGATTTATCATCGCAGTTGCCGCGACTCGCGACAGAAACCGATGCCCGTTTATCACTGCAAACTGCGGTCGAGCTGATATTTTAGGCTAAATCCTGCAGCGAAATGTCGCATTGTGAACCATTCAGAATATCAATGAGAGCGCCGGTCATAAATGACATTTAAGCCGTCGACACGGACATCGCTACGTATACGTAATATTGCTGGGGAATGCACAAGTAGCCAGCTAGCACACACTGCAATGTATCTGCACCCCAGTGCATGTGGAGCCATAAATACCAACCGGCAAGTGGAGTGGACTGTGGGGCCAAGTGTGGAGCAGTGGATCGGATCGCAATGGATTGGATTGGGCTGGATCGGAGCGGGTCGGTCCGAGGAGGCCTCCTAAGGGGCTGGCCGAGACAACGTCACGAGCAATTAACTAAAGCGAAACTCCTTGACCACAGTAGCAGTAGCTACAACACAGGGAATGCAAATGGTGCACAGAGCAAAATAACGTCTGATTATTATTGGATTTTAGGAATATTTCATTTACTTAAATCGAATCAATCTGTTCCTGATTCAATATTCCGTTAGACTTAGGTTTTGTGCTCCGTGCAACTTCAGCCACTTGGTCAGGTTGGTTTGCGGCAGTGGCGACCACAACGTCGAACGGTGGCAACAAACTGCCTGTGTAGGGTTGCCAAAGCGAAATGAATTTTATGGCACGTTACTTATGCCACTGCGCACGCCCCTCCCCCTTTTTGGCGGCAAGAAATGCTGAAATTTATTGCCCTCCACGGCGCAAGCGCAACGCTTCGTTAGCCGAGGCAAACGCTGTCTGGCAGTGTATTTGTCAACCTTTTGCAGTGCACCCTGTATAGTACAGTACAGTGTCTGCAAGGCGGAAGTCTTTGTTTACGGCTTCGTGAGAGGCGGCGACCATATTTGGCTGTTGATTTCTTCTTTTCTGCTCACTTGCTCCTGTAGTTGGCC


Search Again