CR01399

CRIMIC CR01399

Gene CG30427

CG30427

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 long band long bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGAAGCGGAGGCGCATTATTAGG

Amplicon 5' Amplicon 3'
TGTGGTTCATGTGCGGTGTACGTATTAAGAAGCGCGGCAGCAGAAGAGTCAAGCGGGGAGCCCGCGCCGGATAGGAGGACATGAGATCAACCAGTGGCGATGTCATAAAACACACGGAAAGCGTAAACACTTGACGAATTAGCGGTAGGTGGCAAGAAGCGGCTTAAGACTAGCACCAAAGCAACCCCATACCCAACAAGTACATTCATTATCATCTGCTAATGTCTCTGAAGATCTGCTAAAATCGGCGAACTCTGCCGAACTTTGCTCGCTAGTTAGCAAACGAGGACGTAACCCGTCCATATTGGGTGTATCCATGGGCTATTTGCCCAGCTAAGCAGGTCACCCTTGCCTTGAACCCTCCCGGTTACAAATGAAATATTCATCCACTCCTATCGATTTCAGCATTCAGCTAGCCTATCATTAAATAAGTTTGAGGGGAGCTGCCATCGGAAATACCTATTCACAAACATTTTCCTAACCTTATCTGGGCAGTATAAAAATAAAAGATTCGATTAAAGTATACTTTCATATCAAATTACCACTCGGCTTAGTGTTTGATTTTGGAGATTTGCATCAATATGGTCGGACTGGTTTCTGCCCAATAGTTTCTCCACCTCCCATGAATAACGCCCTCTCAGGTTGGCCAAAAACTGCTAATAGAAAACTTTAATTGACTGCCAGCGCAGACAGATCGTACATTCCAGGCAGAGACGTCCAACAAAGACGCCAGGTGGCCGAAAAAGATATAAATAATAAGCAAGCCAGGGCAACATAGACACAGACACAGACATAGACATAGACTTAAGGCGGCAGAAGC AGTTAGAGGGGAACTGGCGACTGGCAATTGCAGACTCAATTTCGCTTCCAGCGCAGCTGGCTACCAAGCAAGCAAGCAATCCCGTCCAGAGACATAGAGAATTAACGACTCTGATAAATCGATTCGCCGCAGGCCAAAGCGACGCGGATAGGCAACAGCGAGGTGGCATCCGTACTTAAAAGGTCACTTACCGATGCTGGGACGTGCGATGATGACGGGCATGGACTCGTAGTGGTCGCGCACCAGAAGCTCCGCCAGACGCTTTGAGTAGGTGTATGTGTTGGGGTGCGGCTTTAGCAAATCCGGCGTAATGGCGTCCAGGGTCTTCACGTCCATCCACTCGGCCAGGCGCATAAGATCCTCCGGCTTGTGTGGAAACTCGTACACCTTCTCATACATCACATCCTGGTCGCAGTTGCAAAAAGCCGTGGACAAGTGGATGAAGGCCTCCAGCTGCTTCATTTCCTTGGCCACGTTGAGCGCTCGCCGGGTGCCTAGCAAGTTCATATCGATGGCGTCCCGAAGGTTGCCCTCCAGCTTAAGGGTGGCCGCCATGTGGAAAACAATGTTAGTGTTCTCGGTCACGTGCTTCAAGCTCTCCCCGCTGAGCCCGAGCTCTACAAATGAAGGGCAGGAAATGCAAATCAATCGAGATTAAAGTGCGGAACTTAAGCGCTACACTTACGGTCGAAGGTGACGTCGCCCTGGTAGATGGTAACCCTCTTGAGCATCTCCGGGCGCTCGTCCTTGATGCGCTGGAAGATGGGCAGCTTGAACATCTCCTCGAGACGCGTCTCGGGTGCCTTGCCGCGCTTCGGGCGGCAGATGATGATCACCTCCTTGAGGGAGTGGCAGGAGTAGAGCAACTTCTCCAGCAGAACCTTGCCCATGAACCCAGACGCTCCAGTGATGAATATCGTCTTATCCTTATAGTATTCCTGCACTGGCGATAGATCCACCGTCATCTTTCTGCAAGAAAGAGGTGTATTAGCACACCTTCTGGGAATGGGAATGGAAATGGAGTGACGCAAGAAGCAT


Search Again