CR01394

CRIMIC CR01394

Gene CG1888

CG1888

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AACCGCCGGCGACAAGCACAGGG

Amplicon 5' Amplicon 3'
GATCTTACCCCTTCGCTCGGTGCGGTAATAGCTGAGCTGTTCCTGCGGGAAAAGCTGCAGTATCTCGCGTTCCAGCAAGTGACTCCTCTGCAGGGTCAGGTGCATCTGGTTCTCCTCGTAGTAGCTGCACACTAGTTGGATGAGCAAAAGGCGCTGCACGGCGTCCAGCGGATCGTTCTGGCCAATACGCTCCAGCAAGCTCTGGGCTTTCATACCCGAGGATCGCAGAATGCCCAAAATGCTAACTTCTTGGTCAGGAGTGGCAGTTGCATCCTCCTTGTTGCCTGAGGTTCCTCCTGAAGACCCAGCCGCCAATACAGCTTCAGGCTTCCTAGTTTGCTGCATCGGCATCAGCTCCTGTTTGACCATCATTATGTCGTCGGTTATCTGCGCAGGCGGATGGACCAAAGGCAATGGAAAGGGAACTGACATTTCCCTGGGATCACTGAGGGCCACCAGCGATTCTGCTGGTATTGTCTTGACCAGATCTTCAGGCTTGTGCAATTCTTCCTGCTCTGACGGCTGTTCCATGTGCAACGGCGATTGCTCCTGACATTGCGATTGGCCCAGAATCTCCGGACAGCGACAGCCGGAGCAGTGGCTCGACCCCTGGCCCTGGGCGCCTTGGAGCGGTACGTTCAGCCAGCGGCGCCAGCGCTCCAAGTGATGCTCGAAGCGAATGCGGGTTCCAAAGCGAAAGTTTCGCAGCAACTCGGACAGATGATGACGTTTGATCATCTGCAGCTCGTCCACGTTAATGGCTTCATCTGCAACACAGTGTGGCAAAGAATAACAATTTTGGTCCGAAGAATAATAACGTTTACTATCAAGAAATTTAAGAGACTTTTAGACAGTTAACTTTAAAACTATGAGTGCATAAACAGTAGTAGTAGTAAATTGCCGTGATATTGCAATCTTTAAACAACAAAAGTGTTAACCCTTAAACACAATTTCTAGCAGTTCCAAGTTTTAACGGAAGCGAAGTATGCAGATCCCAACTCAACGAAACCAAAGTTTAAAACCAACCGCCGG CAGGGTTAAAGTCGCGTCCTCTTTTTGCTCGCTCTTTATCAGCGTCTATGCTTCGCTTTGTTTACATATGGTACATAAGAACAGACATACATACGTACATATTTACGCATGCATGTACAGTACGCATGTATGTACGTATGTTTGCATGTACATACCTTGCAGGTGAGGAAGCAGATCGGCGACATCCCACGACTGCAGAAGGTCGCGCAGCTCCTCGTAGTCCTCCTTTCCAGCCATCTCGAGCAGTTGCAGGCCGTCAGATTCCAGGTTGCAGTTTTCCACGGATCCAGAGCCACGTGGCATCTGTGGGGGCGATGATGTACACGGATTCATTCGACTACAACCGGGCGTACATCCTTTCGTCACGAATGAGAGTGCAGCACTGAAATTTTGCAACAGGCGCGTTGTTCTCTCCCGTCCCTCACCGCACACATACCCTCATACATACGGTTTTCGTTTCGATTTCATCGCCGTCTGTTCTGTTTTTCATCGTTTTTGTTTCGTTCATTCGTAGTCGGCTTCGCCAACTCAACGAACAGCGTATGTACCAAGGGCGTAGTCAGTTATGCAGAAGGGGTTCACCATGGAAATGTGGCTTTAACTAGTCGCTATTAAACGATTGATCGTTTAGTCAATGTATTTGGTTTGGGCGTGTAATCAGTTGTAATTATTACAAATGTAATCAAGACTACGTCCATGGTATGTACGCGTATGTAGACATTCATACCTGAGCTGGCATGTGTGTAATGCAGCGTTGTACTGTTTTCATTTATTTTTGTGTGTTCTTCTGTGGCTGCACGTAAGTTTGTTTGACTGCTTATTGATAAAATTTCGCACCAACCTCGTGGTACGAACCCCTACGATAATGCCGACC


Search Again