CR01390

CRIMIC CR01390

Gene Hakai

CG10263

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 long band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTTGGCTTGACCAATTCCTTGG

Amplicon 5' Amplicon 3'
GCATTGGCATTGTTGATCCTGGTCAAATTGGCCAGCGTGAGCGTCGAGTGGCCGCCGTGGATGGCGTTTTGGGCGGCGGCGGCGGATCCTGGTGGCGGTATACTACCAATACTACCGATGTTACCGACACCGCCGGTCAGTGGCAGCCGCGACAGGACGGGACGGGACGCAATGGAGGCGGAAACGGATATGGGGACAGACGACTCGGAGAGCTGCAAGGGGCAAGCGGTTGTTTTTTTATAGACAGGACAGCTTAGTTTAGGAGCCATAGCTACCACTCGCCTTGCGCTGCTTGTGCAACTCCAGGCCCAGACCGACGCCGCCCAGATCCGTCATTTTTGGCTGCTCCGCCATGGCTGACAGCTGCGGCTGTGGCTGCAACGGTGGCGGCTGCGGCGCCACATGTCTGTGATTGATGTGCGCCTGCAGGTCGCGTTGCGAAAGGTATGTTCTACGGCAGCCGGAGCTGCCGTAGCGACTGCCGCCGTGCGTGCACATGAACACGGTGCCCAGGCCACTCTGCTCCACGCGCAACACCTTGTCCGTGCAGCGGGGACAACTCTTGATGGGCTCGGCGCGGGCGCACTTGAGGCAAAATACATGCTTGCAGGGTATCATGCGGCCGTAGACGAGGATCGGCTTGTCGCACTGATCGCAGCAGTGGATCATCGGGTTCAGCACCTTCTCGCCGATCAGGCTCACCTTGTGGTTCCACTTAAGGCGCAGCATCGGCTCCGGCGGTCCGCGCGAAAGCGTGGTGAAAGTGGGCGCCTCCAGTTGCGATATGTCCGCCTCCATGTCGACTGCGCGGGCGAGAGATAGCGAGATAGCTTTGTTCAATGCTTCAAGTTTGGATACCAAGG TGGTCAAGCCAAGATGTTAATCAATTTAACTATCTTGGACAACCATTCAATAGGGGAGGAGACTCACTTGTTTGGCTCATCACGGGCGGTGGCACTTGCTGCAGGACCTGTGGCTGTTGCGTCGCTGGAGTCATGTTCCCGCTGGCGGCGACCGCTCCTAGCGCACCGTGCGGCAGGGGCTCCTCCAGAGCGCCGGGCGTTTCCAGTTCGCCGTCCTTGTCGAGCTCCTGCATGACCGAATCTTCGGAGGCGTCCAGTCTTCCCGGACTGTCCTCCAGGGCTGCACAGCTGCTGGCCGCCAGGGCTGCGGCGTCGGCGATGCTGCTGTCGTCGATTTTCTTGCCACGACCGCGTCCTCGGCCACGTCCGCGCCCGCGAGCCCTGGTGCCACGCCCTCGTCCGCGGCCGCGCTTCACTTCCTCGGTGTCCATTGTTCACTTGTACTTGCGTGGGATTTTATGCCGGTTTTTAAGTTTTTCGGTTTTTGTTTAGCTCCGCATTTGCGTTTGGCCAGGGTTGTCAGCTGTTCCCACATACGTGCAGTAACTTAGGGTGACCAGTCTGCGCCTAACAACACTGGCCATCAAAAGGTCCGGCATCACTGGTCAGTTTAAAATACAATATTTTTACTTGTTTAATTTTAATTTTATCTGTTTTTCAATTATTTTTAAACTAATTTGAATTTAATGAATGTAAAAAAAAACATAAAAAAAAACAATAATTATAAGCATCTATTTAACCGTTCTTGTATCATATTAATAGCTTACTAATTTCTTTTGTAGCTTCAACATGAAAAAACAAAAGTATTCTGAATAGAAAATGTGAGATCTACATTAAGATAACCTTAAAAACTTAATAATAATTAATAACAAGGTTTAAAATTAGTTTTTTCGTATATAAATTTGAATTTGTAAAATGTTTTTTTAATTACAATTAAATAGTTTTTATTACAAGTTATATTTTTATACTATGCTTTAAAAAAAATGATTTTTGGTATTTGTTGCCTAAAAATATCGTTTATCCCCTTTCCTTATGCTTTAAATTGCGCTCGAATTTATGCAATAACTGAGTTGAGTAGTTCTTCAGCTAGAAATCGGGGTCATTCACCTTGGGTGCAAGGTAGTATCGAATGTGGCCGTAATCCTCGATGGGATACTCCACCAGGAGTGGCCGCTCGTCGGACAGGTAGAGCTTGACG


Search Again