CR01386

CRIMIC CR01386

Gene drl

CG17348

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTCAACGCGGGTTGCACGCAGGG

Amplicon 5' Amplicon 3'
GCTGGGCTTTCACAAGAACGAGCTCCGATTGCGTGTGGGGATTAAATCAATGGAAAAGCCTCTTCTATTTATGCTAATCCTTGGGAAAATGCCAAAATCATCTTACCCGCGCACGGCAAGCTCAAATCAAATAACCTCTGGGCCAACCGAAAGCGAGGAAAACTCCAGCCTGAGGGCAATTAAGCCGGAGGAAAATCACTTTCCCACAATCATGATCGGTGATTAGCAGGGGGTTGTCCGTTTTAATCCTGCAAATGCATCCACTAGGCTGCAAATAAAATGTCTAAATAAACAAAGGCCAATGCACGCGACCAAAAAGCAATTGTATCTAGTGGATACCAACGCATCCAACCAACCCTCCCCTGTCCCGTACGACGAAGTGACAAAAGTCGCACACAACAATGTCAATGACGGAGGAGGGGCATTGGAAAGGTAGCAACCTTTCCAGCGGCACGACGTCGCTACCTAATGGACCAGAAATGCGTCGTGCAAACAAGCAGCCGCACCGGGAGCACCAGGAGCACCAGGAGCACCGGGAGCTCCCCCTAGAATCACAGCTCGGTGTCCCTGACCCTCGTCCTGCCGTCGAACTGCGTATGCAAACAAACGGGCGCAGGGGGAGGAGGACTTTCGCCCGGAAGCGATATGCCGGCCAGGATGGCTCTGCCACTGAAAACTGAATGAATAGCAGGCGGACCCGGCACTTGAGCACGCCGTGGCTTCCATCCCAACCCTCCTCGGAGTCAGCGTCTCGAAGCCTGTTCCACCCCTGGCGAGCAAGGGGTCCTCCTCCTCCTGCTCCTCCTCCTCCTACTTTCAACCCTGC ACCCGCGTTGAGTGCTTTATTTGCAACCGCTGGTGGCAGGGGTGCATGTGGATGTGGATGTGGATGTGCCTGGCCAGGAGCCTTCGCCTGCAGGCGAACTGCAGGCTGACATTACCGATGCTGACAGCGGCACAGTGGTGTGCTGTCACAAAAACAAGTTATATTCACCTAAAGAAAAAATCAATATACCTGTTTATTAAGCTAGAATGCATAAATGCGTTTATGTAATGCGTAAAACTTATGGAAGACATTTTATTATGCTTTGTATTTTACCCACCCTTCGTTCCACTGTCATATGCTTGCCATATTTTTTGATTGCTGGCGAATTCCGGCGGGCGCCTCGACGTCCTCCTCCCTTTCCAACCACCTCTTCGCTTCCCACCACCCCTGGGCCATCTTGACATGACTCTCGTAATGAGCCCGTAAATTATTTTTTATTATTTTGTATTTAATTTTTTCATTGCCCGCCTTTGTTCCTTGGCACAACTCCTTTGCTTTCGGACGACCGACAGGAAGCAGAGGAAAAAATGCCGGCGCGTGTGTGGCATCCATTTGATATGAGAGAATTGATTGTGGGAATCGAATGTGGTGTTTCCGTCGCATGGAAGGAGGAGGAGGAGGAGGGGTGGTAATGAACGGCCAATCGATATTCAACGAGATGGCGAGGCACAAGTCGCCACTGAAGAAGCCTAAATGAAGCATATTATGGGTCTGTCGGGGAATCCATTAACCAAATGCTAATTACTTTCCGCACAATTATGTGCTTCGAGCTCCAAAAATCCATAAGCACATATTTACCCAGTGCAGCTTATTGGAAAATTTCACACGCCCGCACAACAGAAGCTACCATGGATGCAGTAGCTCCAGCTTCTTCCCACGCACAGGGAAGAGATAGCGAAAGTGGGGGACTTTCCCTCTACGAAAACACATCTGGCTGATTCTCTCTGTCTGTGTGCATGTGTGTGTGTGTGTTCTGATAACATGGATGGCAATTAACCATATTCTGGAGCTCTTAAGAGCCCATGAAAAGGCGATATGCATGTGGGGGCCAGTAATGATTTTCTTTTGGGGGATAATCTACAGATTGAACTAACAGCTGAGTGGGGGATCGTAT


Search Again