CR01371

CRIMIC CR01371

Gene CG30158

CG30158

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATGCTGACACGGGGATTAGTTGG

Amplicon 5' Amplicon 3'
ATAGCACACGAGTGGGAGGAGCCTGCGTGGTCGCAGGCATCACAGCTGCCTCCGACGCATCCTTACGACCATGTCATGAAATGGAAAACTTCTGATGGAACATCATTCACTGCTCCGCTGGAGCTGATTATACGCTGTTCAAACTTGTCTTACACCACAAGCACATGTTCGGCGAACAAAAGTTGCTGGGAAAGTTGATTAATAGGTGGGCTGCCTGGCTGGCTGAAGCTGCTGAGCTTCATTATCGGGATTCTAGCTGGCAAAATTGATTCCTGGATGTGCTTTGGTGACACTGGCTCTCTAGGAGGCGGCGTCGTTGCCGGGCTCTTGTCTTCGATTTAATTAATTTCATTTTAGCGACCGACGGGTGCGCATCCATTACTTAAGCCCGCCCAGATTGAATTCCACACGGGAACTGTCACCCGACCCCAAAGTGATTTATTCCCGGCCACCTTGGGTGCAGTGTCCAGACGGTCAGGCGGCCAGGCGACCAGGTGGCCAAATGGCTAGGTGCATCCAAATCAGGTTGGCCTGGACCATTGGCCGCCGGGGCTTGCTATCCAAGCTCGAGTAGCGCCCACAGCCCGCTGAGACTGATTGCCGGAGCAGCATGTGGCCATCAAACGGGAACATTCTATTGCACTAAACGATTTTTGGTCTTTAAAAGCAATTTCGTGTATGTATGTACGTGAATGTGCAAGTGCGCACAGCAGGACGCATTTGATGCCTTAAACATGGATGGTCGAACAAAGGCGGGCCGGCGAACAAAAGCCGAGCGACCGGGAATGGTGTCAAAAATATAAATTGTGTCATTCTGCAAAGTGTTTTAATAAAGTTTACTCATTTCGGCCAAACAATGCGTTACAAATTTGCGTCACAATGGCCCAGGCTGTCAATTGGTGGGCTAAGGACCAAGAGGAGATCACGTCGACAGGGCTAAATGGTTAGATTCGCTGGCTCTGGCTCTTTGGCTTTCTGGCCTCTGCGTGCCATTGACATTCCGGATCGCGTTCTATGCGTATCGCGTACTCGACGCGGCATTATACTCGTAACCAACATAACAGATGCTGACACGGGGATT GCTTCAACCAGGAGTCACGACCCCCGGGTCACCGTCCAGATGGCCAGACAACCGGACACCGCCGATTGGGCGGGGCATTCGTCCTTGTGCTTTCCACGGACATATCGTTTAAAAAGCACTCCATTAAATGTCCTGCGTACAAAGGGCAGTGCCAACAGCAGTGAAAACGACGCCCAAAATAATGGATAAAAAGGGATCCGGACCATGTTTTCCTATATTTAAAGTACCAGAATTTAATGTCGGATTCACTTAAAATGTATATTCCTCGCTCTGGCCTCACTGAAAACAATAGCTATGTTTATTTCCATCTGAATTTGTATCTCCAAAGATATACCAAACTTTAGCTTTTAAGCCCTATTTCCATGCCATTAAAACAGTTGAAAAAACTATACCATTTGAGCACTTTGTCGCCACTAACAAAGTTAATAAACGTTGCGCGGCAATATATTTATACACCTAAAAGAAACTAGGACGGAATACTTTAGGGCAAGTCGAAGTTTATACACCCTTACCGCTTCAACTTTTTCCTATCACCATTATAATATAGGAGTACTCCTTTTTTTTTCAAAAGGTTTTCTATCAGTATTCCATTAATATTTAAATCTTTACTAAGGCAGCTATATGATGTAGTAAGCAGAAATCCAGCAGATAGCTTTTATACTGAGCGACTACTTTAAAATGAATAAAACTACAATATAATTCCCTCTTCAAGAGTATATAACCATACTTGGCAAATTTCCGATAATAACTTTTCGTCGGTCTTTTTTAGCTGCAGCAACCTTTTGTAACTGACACCTTTGGACCAAAAGACTTTCACATTGTTAAAATCAAGCGTTGGAAAATGGGAACTTTTAGTCTCTTAAATTTGATTTAGGTTTGGTCATCATAGTAAAGAAGTGACAAGAATTTTAGCATCAATAAAAATAATTCTAAATTATTAAAAAAAAACAAAATTTGTACTGCCTACTTTCTATAAGATACATGGTCTAAAGGAGAGCACAGCAAGTAATCAAATAGATTCGTTTAAATATTAATTTTGTTCAGCTCCAACATCTCCCAACATCACAGTGCTGCCTTTAATCAAAGGACCTGCAAAATAAAATTGGGACGGTGGTTTATCGTG


Search Again