CR01365

CRIMIC CR01365

Gene CG5850

CG5850

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK83289

Images

Construct Sequences

sgRNA sequence
TTTCGGTTATAAGATAAGGTTGG

Amplicon 5' Amplicon 3'
ACCAGCACCGTCATCTTCAGCGTCTCCATCCTCTCCGTCCACGTCCAAGTCACCGTCGTCAGCGTCATTATCCCCGCCCGTTGAGTTCGACCACTCGGACGCCGACTGATTGCTGCCAGTGGCACTAAACTTGAGGCTGCTTGACATGCCAAACGATACGGATAGCGAGGCGCTGAGTGACGAGGCATTCAACTGCTGGCTCACGTCCACGCCATCTTCGTCCTCGAAAGCGTCGTCAATGTGCGGGTGCTGATGTTGCTGGTAGTGATATTGTTGGTAGCGGTGTCACCTGCCTGCGCCCGCACCCAACAGCAGGGCATAATCATCGTTGGACTCGGGAATTGGCGCCGCTGCCGACGCGGCACCAGGGGGCAGGCGCAGGAAACTGCCACCGCCGCCAGCACCCGCACCCGGATCCCTTTCGCGCTCGCGAAGATGCAGTGTGTCGCGTTGACGGGTCGACGGCTGAGAGCCTGCCGCTCCCGGCAAGTGTAGTTGTTGTTGTTGGTAGTTGCTATTGCTACTGTTCCCATCGTCGGCCACGCCTGCTAAAGGAAATCGAGATTGGGAGTGAGTAGATTGACTTTCGGGCAGTGTATTCAGCTTGCCATCATACACAGGCACGATCAGGCGACTGGACGTTGCACCATACATGTTACCTGATTGTGACGAGTTGCCCGGCAGCTGCTGATCTTGCCGCTTGCTGATCAGATACTCGGACTCACTGCTGGAGCGGCGAGGACTGCGCGCCAGCGGCTGGTATGTGCTGCGTCCCTGGAAGCGACGACTCAGTGAACTGCCCACGACGCCCAGATGCTCGGTGACATCCTCCTGCATGTCGGATATGTCCATCATGGAGAGGAAGGCGCGACACCAGCTATGGTTCGGGTTGTTCCAGTACTGCGGCGAGTTGATGTGAAACGGATGGTGCGGGAAGCTGTAGATGTGAGCCACGGCCGCGATAAACATTTCGATGCAGATGAGGAAATTCTGGTTGGCGATAACAAATACATACATATTTGAATTGGTTTTTGGAAACTTTCACTTCGGTTTCATTTGTTGTGTTTGCAAATTTGGAAGTTATGCTTGATAAAAACTCTTAGTCATCAGTATTAAACGAACTTGGGACTGTTTTCGG AAAATCATGCTTAATTTACATATTAGCTCTTTACTTATAGAAATAACTTATTGCCAGATCCATTCGGCTTTTAAATAGGTCACTCACCTGAAGCAGGGAAGCCAGATTGGTGTCTCCCACATCCGACCCAAAGATGTCCTTAATAATATTATAGTATACCAGTACGTTGAGTAGCACTCCTTGGCTACGGTGGAGTAAAATATTCTTAACCAATCTTAAATGCTTTCATGTGGTACTTACAAAAACGAGAAAAACACCACAGCCTTGATGCACAGGAATTTGGGAATAGGCTTCATTGGTTTGAGATCCTCCTTGTTTGCACGGTAAAATAGCACCAGGCAATACATGGCCACGAACTGGGATATATTGTTGACCACCACAATATAGGGGAAGGCCACGTTGCCCGCAAACTCGCCCTCGCCGTAAACGCCGCATAGCTCGCAGATGCTACGAAATTCCGATTAGAGTTGACTGTTAAACGGAAAAGCACATCCCGACACTCACACAGAGATAAAGGTGGTAATGGGGCGCACGACCGTGTACTGGAGGATGCCGTGCTTGCAGTTGTGGATGAATTCACGACCCATCACCCACGGCCGCATGCAGCAGAGCGGAAAGAAGTGAGGCACCTGCGGCTTGTACTCCATTGTGGCCTCTAGGTCCATACCGAGATTCAAGTAGTT


Search Again