CR01360

CRIMIC CR01360

Gene CG3515

CG3515

Information

Donor Location Cytology FBti Stock number
pM37-p02L:2552439..255246022F4FBti020691583287

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band

Images

Construct Design Sequences

sgRNA sequence GTGAATGGTTAGAAGAGACACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TCGTCCTAGGAGCCTTGACA ACACGGCTTCGAAAGAGG GTGTATCTTGGCCCCACCG GGGTCCTCCGTTGCACTAAT
 
Amplicon 5' Amplicon 3'
TCGTCCTAGGAGCCTTGACAGCCTCCTCCTGTACAGTTTCGTCCGTAAAGGAGATAGTTTCGCCGGGCTTCAGGCGTTTCACCCAATCGTAAACTCCATTCGCCATGGGCATCCAGAACACGATTCGTGAGTCGCTGCTCACGAACATGGTGGCTCTCGGATTGAAGCGCATGCATCGAACAGGACCCATATTGTTGCCCTTAAGCACTGCCACAGGAAATCCATCGGCAGCGCGCCAAATGTGAATCCTGCCCTTATCCGCTCCCGAAAGGATGAACTGCGAGTCCGGCGTGTAAGTGGCATCCAACGGCAGCCTTAACTTATTCGAATAGCCAGTAAAGGACTGTTGGTAGGTACCATCAATGGCCGAGACACTGAAGCACCAGGAGTGATCCGTGCTCAGCAGCAGGCTCTTCCCGTTGGGAGCGAACTGCAACTGTGTCCAATTGGCCTTGGCGTTCACCTGGTATACGAACTTTCGGCTCGGCTCACCGCCCATCATCCTCACATCGCGGATCTGGATGCCCTCCGTGCCCGAACTGGTGGCCAGGAACAAGCCCTCAGGATCAAAAGCGCATAGTGGCCGTCGCAGATTCTTTATGCGGTGTGTGTGAGTTTTGACCCGAATGTCCCACATGTAAACCTGATCATCCCGCCCGGCACTGATGAACACATTCTCGCCTCCAGGCTGGGAGGCCAGCCTATTGATAGTCTTTGCATGGCCACCGAAAACTCGAACGCAGTGGCGGGTATTAAGGTCCAGGCATCGGATGGTGTAGTCATGCTGTCGATGGTAAATTTAAATATGTATAAATTTAAAATTGAAATATATAAGAAATGTCATTTTATGCACCAAAACCATTTTTAAAAATAATGCCTCTTTCGAAGCCGTGT GTGTATCTTGGCCCCACCGTTCCCCTTTAAAGTTTCTTACCTTTGAGGTGGAGTGCAGGACGCGAGTGTCCTGCTGGACGAAGCAGGCCACGTCGGGCAGGTAGTGGTGCATAGGCACCTTGCAGACCTGCACCTGTCGAGTGCTGCTGAAGATCGAGAGGGCGGAGTGGTCGCAGACCAGCAGGCGCAGTCCGTCCGAGGAGAACTCCATTGCAAGCGTGTGGTGCTTTGTCTCCGGGAACACCTTGGCCACCCGGAACTGCCGCATCGCGTCATCGTTCAGTCTGATAGACATTTCCTTTAAATATGTACTGTGAGAAAATGAGCTTCAATAAGAATGTGATGTTAAGGCCTGTCATTAAAATTATTTCAATCTGTCATTTTGAAGTAATTCTCGAGAGTATATTGTTTTAAATTTTTATTATACGAAAGCGACAGAAAATTGATCCTTTCTTAGCAAATTCAACTGATTTCCTCTTCCTCGCGGCCAAATGCCACTAACTTTATTACAACTGACTGACTTTAAAACTAAATTAAGCCGATTTGAGTTTGCCCCGGATCAAAATGATTAAATCAAGTGTTGAACCGTCTGCCACGCCCACCGGATCGCCCACTGGCACAGCTGGGGATGCATTTTAATTTCCTTTTCGCGACCAGCTCCCAGATAGCCATGTTCCCCATCATTGCGCCTCATTAGGGCCGTGGGTGGTGTGTGGTTTTGGCTGGAAATTGAAGGAAAAACTGTCTGCTGAGTTGGCAACGCAGCTCGCCCCATTCGCTCCAATCTCCACTTGTTGACCAAATGCCAGCAACTTGTTATTTAGGCCGATTTGTGTCATTAGTGCAACGGAGGACCC
 

Search Again