CR01360

CRIMIC CR01360

Gene CG3515

CG3515

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GTGAATGGTTAGAAGAGACACGG

Amplicon 5' Amplicon 3'
TCGTCCTAGGAGCCTTGACAGCCTCCTCCTGTACAGTTTCGTCCGTAAAGGAGATAGTTTCGCCGGGCTTCAGGCGTTTCACCCAATCGTAAACTCCATTCGCCATGGGCATCCAGAACACGATTCGTGAGTCGCTGCTCACGAACATGGTGGCTCTCGGATTGAAGCGCATGCATCGAACAGGACCCATATTGTTGCCCTTAAGCACTGCCACAGGAAATCCATCGGCAGCGCGCCAAATGTGAATCCTGCCCTTATCCGCTCCCGAAAGGATGAACTGCGAGTCCGGCGTGTAAGTGGCATCCAACGGCAGCCTTAACTTATTCGAATAGCCAGTAAAGGACTGTTGGTAGGTACCATCAATGGCCGAGACACTGAAGCACCAGGAGTGATCCGTGCTCAGCAGCAGGCTCTTCCCGTTGGGAGCGAACTGCAACTGTGTCCAATTGGCCTTGGCGTTCACCTGGTATACGAACTTTCGGCTCGGCTCACCGCCCATCATCCTCACATCGCGGATCTGGATGCCCTCCGTGCCCGAACTGGTGGCCAGGAACAAGCCCTCAGGATCAAAAGCGCATAGTGGCCGTCGCAGATTCTTTATGCGGTGTGTGTGAGTTTTGACCCGAATGTCCCACATGTAAACCTGATCATCCCGCCCGGCACTGATGAACACATTCTCGCCTCCAGGCTGGGAGGCCAGCCTATTGATAGTCTTTGCATGGCCACCGAAAACTCGAACGCAGTGGCGGGTATTAAGGTCCAGGCATCGGATGGTGTAGTCATGCTGTCGATGGTAAATTTAAATATGTATAAATTTAAAATTGAAATATATAAGAAATGTCATTTTATGCACCAAAACCATTTTTAAAAATAATGCCTCTTTCGAAGCCGTGT GTGTATCTTGGCCCCACCGTTCCCCTTTAAAGTTTCTTACCTTTGAGGTGGAGTGCAGGACGCGAGTGTCCTGCTGGACGAAGCAGGCCACGTCGGGCAGGTAGTGGTGCATAGGCACCTTGCAGACCTGCACCTGTCGAGTGCTGCTGAAGATCGAGAGGGCGGAGTGGTCGCAGACCAGCAGGCGCAGTCCGTCCGAGGAGAACTCCATTGCAAGCGTGTGGTGCTTTGTCTCCGGGAACACCTTGGCCACCCGGAACTGCCGCATCGCGTCATCGTTCAGTCTGATAGACATTTCCTTTAAATATGTACTGTGAGAAAATGAGCTTCAATAAGAATGTGATGTTAAGGCCTGTCATTAAAATTATTTCAATCTGTCATTTTGAAGTAATTCTCGAGAGTATATTGTTTTAAATTTTTATTATACGAAAGCGACAGAAAATTGATCCTTTCTTAGCAAATTCAACTGATTTCCTCTTCCTCGCGGCCAAATGCCACTAACTTTATTACAACTGACTGACTTTAAAACTAAATTAAGCCGATTTGAGTTTGCCCCGGATCAAAATGATTAAATCAAGTGTTGAACCGTCTGCCACGCCCACCGGATCGCCCACTGGCACAGCTGGGGATGCATTTTAATTTCCTTTTCGCGACCAGCTCCCAGATAGCCATGTTCCCCATCATTGCGCCTCATTAGGGCCGTGGGTGGTGTGTGGTTTTGGCTGGAAATTGAAGGAAAAACTGTCTGCTGAGTTGGCAACGCAGCTCGCCCCATTCGCTCCAATCTCCACTTGTTGACCAAATGCCAGCAACTTGTTATTTAGGCCGATTTGTGTCATTAGTGCAACGGAGGACCC


Search Again