CR01357

CRIMIC CR01357

Gene knon

CG7813

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band83284

Images

Construct Sequences

sgRNA sequence
GAATTAAGTCTACCTTAGAAGGG

Amplicon 5' Amplicon 3'
CCCATTCCTCCGCCTCTTTTAATTGTCTCTTGCGCTCCAATGTCCTAGCTATCTCCCTGGCTCGCTCCTCCTGGGCATCGCAAGGATCCGCCTCAATGGAAAGGTTAGTATGCCTGGCCTTAACCTCCGGATTGGCCTCTGCCTCCTCGCTGCGTATTATAGTTTGGTTGCAGATGTTCGGTCCAGACTCTCGTTCCGTAATGCTGTCCAGTGACTTGGTTGGTGCGGCTGTAGGCGTTGCGGATTTGCTGGCAGTTTCGGAACGCGCAGCTTTGGCGGCGTCTGCCTTTTTCTGAACATTCTTGGCCAGACCCGACATCTTTTCTTTAAGACTATTAAAAAGAACAATAGCTTTGGCCATCAAATCTTTGGCGATTAAAGTGGCCTTTTCGGCCAACTGAGAGGTGTCGACAACGGGTTCTTTTGGCTCCTTTGGAGCCGCAGCCGCCGGAGGCTTTCCTTCTCCACTAGGCTTATCTGGTAACTTTTCGGGAGCTGGTTTCTTTGGCGGTTCGGGCTCCTCTTCGTGATGCAAAGCAGCTGCTGCCTCTGGATCCGATGGACCTGGCATTTGCTCTTCAGGAGTGTGTGGCCAGAAAGTGGGCTTGTTGATGAAATCGGGTGCCAAGTGCGGACGGGCAAAACAAAATTCCTCCATGGTCATTTCGGAATAGGGTCGCATTGCCTTCACGAACTCCAACTTTTCGGTTAGCTCCTGGATTCTTTTATCCGACTCCGCCTTGTATTCGCTAATACATTTTGTCACCACCTTCTTTTCTTCATCGACGAGTTCAAAGTATCGCTTGTGATCTACTATGGCATGTCGATTCTCGAATACGGAATGCAATTTATCATACTTGGTCTCGTATCCCTTCACCCAATCGACAAACTCTTCTCTCACATTCTGACGGTAGTATTCCCAGTCGATTGTCGGCATCGATTCCGGATACTTACGAACGCGGCTATAAAATATATTTATATTATTCTCTACAATGGGAAATAATTCTCATATAAAGCAACATAAGCTGTAACCTAAATAATTAGTAAAGACCCTGCCCTTC AATTCATGCTCCCCCAGGTGACCCCAATTCCCTGTTTTTGGTGACCCCATCTTACTCCTTGTACTCCTCGTGCTTCTTGGCAAACATTTTGAACTTGTGCATCTGGTTCGGCGGCACCTGTTTCATCAGATCCGCCAGTTCGACAACTTGGCAGCTTACATTCTTGACGCCACCATTGCCACCATTGCTCTTGATGCAGTTCACCAGCTTTTCCCACATCCTTCGGATTCTTTAGCAGTATTTTTATGGATTTATATATGTGTATGTTCAGGTGTGTTCACATTGGCCTCCAGTCTGTTCTATAACTTGTACAAATATGTGAGTGCGTAGTGTGTGTGTGTGTGTTGAAAACTCCTAAGGAGCCAACTGAGAGCCATTAAAAGTGAAAATTCCAAAAGGCTATAAAAAAAAACGGGGTGGGCGGAGAAATCGAGATTTCAATTTATAGCCCGAAATTGCATATTCATGCAGTTTCAATTAAATCAGAGTCAGGCGCAGCGACAGCTAAGCAAGTGGGTTTGACTAACTGACAATAAAATCGAAAATTAATTCCAACCCAGCAGACTGCTCAAGGAAAGTTAAATGTAATTGCATGGAGATGGGGTATTTTTGGGGTGGCATTGCCAAGTGGGTGGAGTGGGTGGAAATGTAAAATCACACCCAGGATATGCGTATGTGTTTGGGACCTCTCGAGTCTGCGAATGCTCCAAAGTGACAAACGCAATTTATAACGCAACGAAAATGGGCTAATGCCAATTCTTCAGGTAATTGTCGTCTGCTCTCTCTCTCTCTCCCTCTCACTCTCTTTCTCTAGAGAATCATGGTGCGAGAGAGGGTGTGCGAATTGCAACCCCTGCTGGAATCGCAGGATATGCTCCTTTAAACGTTTTGGAACGAAACGAAACATGCGCCTGCGCTCTGTGAATGTTTCGCTGTCATTTTGACAGTTGCGAATGTCCTCTCACCAC


Search Again