CR01355

CRIMIC CR01355

Gene wde

CG12340

Information

Donor Location Cytology FBti Stock number
pM37-p22R:10801735..1080174247C1FBti020691083282

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence TTGAGATCTCGGCGATTATACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TCCGTCTACGACCAGGTCTT CGCCGAGATCTCAAATTCTTCG CGGACGGACAAATGGACG CCGCACCAGAGTCAACTCAT
 
Amplicon 5' Amplicon 3'
TCCGTCTACGACCAGGTCTTGGGAACACTGAACGGCCCGAATCGTTCGTGACTATCAACGCCCCGCACAGCGAAGTAATACCTCTGGTTCTCCTGGAACTGATTTAAAGTCACTGCCATTGGCAGCAACATAGCGCTGACATCGCCCACATGCCGCCAGCTATCCGTGCTGGGCTCGTTAATCGTCTCCTGGTATGCATAGATCTGGTACATTACGCACTCTGCGAACCGCGGGCTCGAATCCTCCAGAGTCCAGGATATAACGATACCAGTATCAAGGAGACTAATCCGGATAACGGGTCGCGAAGGAGGCACCTTCCAGGATGGATTGAAGGGCTGGGGAGGAGACGTGGGCAGTGGTGCAGGATGTGAGTATCTTAGACGAGACGCTGGAGGCGGGGTGTTTTCCGAACGTATCTGCATAGTTACGTTTGAGCCCAAGGGACTTTGCTGACCTTTGAATACGTTTGAAAATAAGTACGCCGAATATTTTGAATATAATGATTTTCCAACTCACCTCCTCCATTATTATGGACTATCTGTCGAGCATTTACGCGAGGCAATTGCATTGGAGAAGCTCGCACCACATTTCCGCCTCCTCGTCCTCCTCTCGTCGCTGCTGCAGTCTGAGCATTCCGCTTAAGCATCTCCATACGCAAACGAGCGTTTTGTGCTTGGGCAGCCCTAGCCGCCGCCGCAGCCGCTGCATCATCCTCATCTGTGAGGTCAATGACTGCCTTCTCCTTGGGCTTGGCCGGCGCCAAGCTGGACTCCTGCTGCTGTCCATAGCTGCCCAATTCCGATCCACTGCTGCTAGATGAGATGGGCACCGAGACCGTGGCCCCCGAAAGCGGTGGCTGCTTGGCGCGCACTTTAGTTGTGCACTTCGGCACTTGCTTGGCGGGACTCGAACCTGGCGTGGGACCGGGACTAGGTCGAGGTCTGCAATATGAAACAATTGTAAGTTAGTAATGTGAATATGACATGTTTCTTTTGACGAAGAATTTGAGATCTCGGCG CGGACGGACAAATGGACGGACGGACATAAACATATTGATTCGACAAGTATATTTTTATATTGGTAACGCTTTTATTTACCCATTTGGGTTTATTACCCCAACTATAAAGATTTTCAATAGCAATAAAATATACTTGAATGTTAAGAAAACAAAATTTTTTCTGGCATATCAATACAAATTGGGAAATAGAATAATAAAATTTAAAAAAAAATCTATGTATGCTTTTATAGCCACTGAGTTCGAGGCGTTCATATGGACACACGGACGGACATGGCCTGATTGATCCAGATAAAAAAAATATATACGGAAACTCTGCCTTCTACCAGTTATATACTCTGTAACGAATCTAGTATACCGTATTACTCTACAAGTAAAAATATGAATCTATTTAGCTAATTGGGTCTGAAACGATTCCCAATAAATTGCTAATTGTAAACTTCTGCACAAGCGTGGAATTCGCTTTTAATCGAAGATCACGATTAGGATTATACTCACAGTAGGAACTGTTGCTGCGCCTGTTGTTGCTTTTGTTGTTGTTGCAGGTGTTGTTGCTGTTGTTGCTGCTGTTGCTGGTGCTGTTTCTGCTGTTGTTTTTGCGCCAAGAAAGCGGCTTCTGAGTTCCGGGCACGCATGACGGTTTTATTAATCGCATTGGCCACCGATGAAGGCGTGGAGCCAGGCGTTCCGGTGTGCTTGGAGGCGTGCATTGTCCTTTGAGCTATAGGCGGTGAGGACTGCAGACGTTGAACGCTGGACTGATTCATAAGCATTGGCGCGGGCTGTAAGTTAGTAGGTACCGGCCGATGGGGCGTGACCTTCTGCAAGCAGCCCCGGCGCACAGGTGGCGTGACACTAGCCGTTGTTAAGGATTGAGATGACCGTGCTGCTGGCTGCTGTTGCTGGTGATTGGAATTCGGAGTGACACTGACGCCCGCACCCGTTTCCGATGAGGATGTGGATGGTCCAAAGGTAGGCGGAGGAGGTCTTGGTCGCACGGTCGCACGCGTCGGGGAGGTGCTGGCCTTGGGTGGTGTTCCGCTGGGCGGCGCCAACACGCTGCCAGCAGCATGAGTTGACTCTGGTGCGG
 

Search Again