CR01355

CRIMIC CR01355

Gene wde

CG12340

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK83282

Images

Construct Sequences

sgRNA sequence
TTGAGATCTCGGCGATTATACGG

Amplicon 5' Amplicon 3'
TCCGTCTACGACCAGGTCTTGGGAACACTGAACGGCCCGAATCGTTCGTGACTATCAACGCCCCGCACAGCGAAGTAATACCTCTGGTTCTCCTGGAACTGATTTAAAGTCACTGCCATTGGCAGCAACATAGCGCTGACATCGCCCACATGCCGCCAGCTATCCGTGCTGGGCTCGTTAATCGTCTCCTGGTATGCATAGATCTGGTACATTACGCACTCTGCGAACCGCGGGCTCGAATCCTCCAGAGTCCAGGATATAACGATACCAGTATCAAGGAGACTAATCCGGATAACGGGTCGCGAAGGAGGCACCTTCCAGGATGGATTGAAGGGCTGGGGAGGAGACGTGGGCAGTGGTGCAGGATGTGAGTATCTTAGACGAGACGCTGGAGGCGGGGTGTTTTCCGAACGTATCTGCATAGTTACGTTTGAGCCCAAGGGACTTTGCTGACCTTTGAATACGTTTGAAAATAAGTACGCCGAATATTTTGAATATAATGATTTTCCAACTCACCTCCTCCATTATTATGGACTATCTGTCGAGCATTTACGCGAGGCAATTGCATTGGAGAAGCTCGCACCACATTTCCGCCTCCTCGTCCTCCTCTCGTCGCTGCTGCAGTCTGAGCATTCCGCTTAAGCATCTCCATACGCAAACGAGCGTTTTGTGCTTGGGCAGCCCTAGCCGCCGCCGCAGCCGCTGCATCATCCTCATCTGTGAGGTCAATGACTGCCTTCTCCTTGGGCTTGGCCGGCGCCAAGCTGGACTCCTGCTGCTGTCCATAGCTGCCCAATTCCGATCCACTGCTGCTAGATGAGATGGGCACCGAGACCGTGGCCCCCGAAAGCGGTGGCTGCTTGGCGCGCACTTTAGTTGTGCACTTCGGCACTTGCTTGGCGGGACTCGAACCTGGCGTGGGACCGGGACTAGGTCGAGGTCTGCAATATGAAACAATTGTAAGTTAGTAATGTGAATATGACATGTTTCTTTTGACGAAGAATTTGAGATCTCGGCG CGGACGGACAAATGGACGGACGGACATAAACATATTGATTCGACAAGTATATTTTTATATTGGTAACGCTTTTATTTACCCATTTGGGTTTATTACCCCAACTATAAAGATTTTCAATAGCAATAAAATATACTTGAATGTTAAGAAAACAAAATTTTTTCTGGCATATCAATACAAATTGGGAAATAGAATAATAAAATTTAAAAAAAAATCTATGTATGCTTTTATAGCCACTGAGTTCGAGGCGTTCATATGGACACACGGACGGACATGGCCTGATTGATCCAGATAAAAAAAATATATACGGAAACTCTGCCTTCTACCAGTTATATACTCTGTAACGAATCTAGTATACCGTATTACTCTACAAGTAAAAATATGAATCTATTTAGCTAATTGGGTCTGAAACGATTCCCAATAAATTGCTAATTGTAAACTTCTGCACAAGCGTGGAATTCGCTTTTAATCGAAGATCACGATTAGGATTATACTCACAGTAGGAACTGTTGCTGCGCCTGTTGTTGCTTTTGTTGTTGTTGCAGGTGTTGTTGCTGTTGTTGCTGCTGTTGCTGGTGCTGTTTCTGCTGTTGTTTTTGCGCCAAGAAAGCGGCTTCTGAGTTCCGGGCACGCATGACGGTTTTATTAATCGCATTGGCCACCGATGAAGGCGTGGAGCCAGGCGTTCCGGTGTGCTTGGAGGCGTGCATTGTCCTTTGAGCTATAGGCGGTGAGGACTGCAGACGTTGAACGCTGGACTGATTCATAAGCATTGGCGCGGGCTGTAAGTTAGTAGGTACCGGCCGATGGGGCGTGACCTTCTGCAAGCAGCCCCGGCGCACAGGTGGCGTGACACTAGCCGTTGTTAAGGATTGAGATGACCGTGCTGCTGGCTGCTGTTGCTGGTGATTGGAATTCGGAGTGACACTGACGCCCGCACCCGTTTCCGATGAGGATGTGGATGGTCCAAAGGTAGGCGGAGGAGGTCTTGGTCGCACGGTCGCACGCGTCGGGGAGGTGCTGGCCTTGGGTGGTGTTCCGCTGGGCGGCGCCAACACGCTGCCAGCAGCATGAGTTGACTCTGGTGCGG


Search Again