CR01353

CRIMIC CR01353

Gene Gr43a

CG1712

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK (weak) OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTACGGGCTTGTCCCATTCAAGG

Amplicon 5' Amplicon 3'
CACGGTGCTGACCTTTTGTGGCTTGATGGCACTGGTTGCATTGTTCTCTGTTGGGTGGTTTACAACTAATCAAAAATCCTGGAAATTTAAATTACCACTTACCTGCAAGAAAGCTGCTCGAAAGCATTCGGTTCAGACGGCCAAAGCGCCTTCCTAGTCCATAGGCCGTGTTGGCAATGTTAACCTGCAAGCCCGTGAGGATGAAGTAAAGACTATAGAATGGAATGTACCAGTGCACATTGAGCTCTGTCGAAGAGAAAATGAAAAGGTGGGGATTCAAAGATAGATTTCTTTCATTTTAAGATTTATTTGGCGGCTTATAAATGAATACATTAAAGCGCTAGCTACCCGTATCCGACTGAGCTATGTTCATATCCTGGGCAATGCGCATCCACGTCCCTACATCCAGGCCGACCAGAATCGAAATGGCCAGCAGAGAGACGGCAGCCATGCCCAAGGCTCGCCATCGATCTCTTCGAAAGTTATTGTAGGCATTTAGGGTATTATCGATCTGGGGTGTTTATTGGGTGATTATAACAAATAAAAGGAGGGTGGATCTATGATTGACGTGATCTCACCTTGTTTAGTCGATCGTTGAGCTCGAGAGTGTCGTTCAGGCTGAAAAGGCCACAGTAAACACCGGATACAATGGCCATGACCACCACAGACACGTCCAGGGCCGTCACCACCTTCGACGTAGCCGACTTCATTCTAAAAGATGCACTTTTGATTTGTTGGTTGGTTTTGTTTGCAGTTTGTCAGAGCAATTAATTGGTCAAGATCGAATGTGTTTAGAAGGGAGCAGAGGTGATGATTAGATAGAGAAAAATCGAGAAAAGTATACACACAATTAGGATCAAAGTAATGACACCCTCCGCAACAAAATCATATCCTTCTTGAGAGGAAAGTATTACTTATACATATTTGATAAGATATGGGTTCTAAAAGTGCAGGACTCCACTCCGAGTG GGACAAGCCCGTAGAGATTAGTAAAAAAAAAACGGCACAGAACTGGGACCTTACAAGTAGGAAACATAGATGTAGATACAAAAGTACCTACCGCACGGGAATTTCGGAGTTAGCATCGAACAGGAGACCCCGATAAGTGAGAAAAACTACGCAGATGCGGATAGCGTTTAGTCAGAAGGAAGTCACCCGCCTTTGGATGCTCAACTCACCCATAACCACCGTTAATGTGGCCGAGTATACAGTGAAGAGCCAGCTGCGACCAATTTCCACCCGGCCCTTGGAGTTCCGGACCGTAGCATATGGAGCCAGGGCCAGCACTTTGCTGATGTAGAAGATGCCGATGCTGGGCTGGGATATCTCCATAGTAATTCAGAACGCGGGACACTCGCAGTACGACCTCTGGACGAGAACTGTTCTCGAGTCGCCAAATACAGGACCTTAAATTGCAAAACGCCATATTCGACACCAAACAAATACTGCGCTCCCATATTTGACTATTATTAGTGGCCACCACCATCCACGCCCCACACCATGACCACATGGCCCTCGCAGACCGTCTGGGCAAACACCCCATGTGCGAGTGAGTAACACATTTGCTTATCAAAAAGCTCGGCTGTCCGCGATGTAAATAATAATTAGCGTGTGAAAATACCAAGCCGGAAAAAGGACACAGGAGCAGGAGCCAATTATTTTGGGGCCGACGTTGACAGCTGCGGCAGCTGCGACAGGTGCACCCGAGTGAATGAGGTCCACAGCCCAATTGTTACACAATTTCTCATTTATTGTTGCGACTCCACTCGGCGGTCCAGCCTAGTGGGGATCGCTATTAAGGAACAGTGGCAGATGCGCAATTAATCAAGTTAATTCTATCTGCCAGCCAGACTAGACGGAGTGT


Search Again