CR01352

CRIMIC CR01352

Gene CG33680

CG33680

Information

Donor Location Cytology FBti Stock number
pM37-p22R:25250133..25250149?FBti020690783279

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence CGCTTTACTATCGATTCGATAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
AATGGTAATCTGGGCGGGTG AAGCGCTTGTCTGCAACAAC AGGCAGTAGATCGTGCTTTT TTACCCATGTTGCCACCTCC
 
Amplicon 5' Amplicon 3'
AATGGTAATCTGGGCGGGTGTGTAATCGGACTGACAAACGTCTTTCCAGGAGGGAACATCTCATCGAATGTGGCACTGGCAAGGATTTTATCTGCCACATCTAAAAAATGTTTAGAAAGACCGTGCTCCAGGCTTGGCGCAATGTCTTTCAGATATAATTCTTGATTGTTGTTAATAAGACTATTTCCTACGTCTCCCAAAAATCTATCGCCGCTAAACAGGTTTGCCAGCTTTAATTTAAAATCCTTAAAATCAATCAGTGTGGTCATCTTGCTGAATTTCACATAGTCTTTGCCATTTCGAAGATACCGAGACCCACGAATTTTAACGAATGCTTTTGCGTTTTCTGATATAAATCAAATGAGTTGTGTTTTAGTTTTTATGTTAAGTTAAAACCTACCGCAATATCCCTGCATGTTTCCCTTTCCTTTTATGTCTGGGAGTAGCAAATTCAGATGCAGCGAGTACTTCCCTGTATAGTCTAAGCTACATTTTAACAATGATTATACTCAAGTACATAAGACGTTCAATGACAAAGTTGCTCCCTCCGTTGGCTTCAAGATCTTTGAAAACAGCTTGAAATTGGCTGCTTAGTTTCAGTTCAATATTATCTAAGGACAACGGTTCTAATGGGGATGTTGGGAATCCATCCCCCAAGTTGCCATGCACTAGTAAAGGCCTTATTTGATACGCAGCGTTTATAATACAGCGCTCCAAAAGAGGTTCATTGCGGGCGCATGGTGTTATTGTGAACGCTAACAGAAAAATATTTATAGGGAATAAAAAATTACTATTTGAGGTGCAATGCAATTAGAGACGTTATTAAAAACCGTTACAAAATAATCCCTTGCACTTGGTGCAATTGGATACTTACGCAGCTTTGCAATAATTAAAGGACACTGCAACAATAGCCACACCAGCAATAATACGAAGCTCTCAAAACACCTATAGTAAATAATTTCTAGAGCGGTTTTATACAATGTTTTTGATTTGAATGAACTGTAGTTGTTGCAGACAAGCGCTT AGGCAGTAGATCGTGCTTTTGATTGAATTAAGCGTGGTTAGCTAAAGTCTCTCCCTCTCTCGCAACATTTTCGTAGCAATAAACGAGCAGCTTACACTTACAAATTCACAAGACAACGATAACGCAGTTGCCCACTGACGCCACTCGGGGGCACGTGAGTTGTCGCATTGCACGTTAAGTTAAATTTATGTGGTTTAAAGTGAATTAAAACAATGCCGAATTCACGGCTTTAACATTGAATAACAAATGCAACCAAATCAGCTACGAAAATTTAAATAATAAATTTATCTGCATTCTCCAAGGGCCAACATCGTCGCAACAGTTATAATGTATGCGTAAGGATAAGACAAAACTAGATTGGGGATAACATCAACACCAATCAGGAAACACAAAATGTTTATTTTTTTGCAATGCAAATTTGAGATTTATTAACGAAGCAAGCTAAACATAAAATAAACATTATACTTTGGTCACCATTTTACCAGCAACTTATTGTAAAATATGTAACCATCGCGAATGCTGTCACCAAAAGTAATCATTAAAATTTTATAGACTGTATAAATTGAAATTTAAGATAAATTTAAATTATTTAAAAAATCTATATATAACAAGAGATTCCAGTTCCCTGACTATCATATACCCGTTAATCAGCTAGTGGTAGTGCCAAGGAGAAATTTTCACAGTTTTCTGGCATCACGATAGAAATTATAAATAAATACTAAGACAAAAAAAATTTAATATTTCAAAGGTTTGTGAGCTTTGAAAAAGGTTCTTTGGCCTCGATAGATATTTACAAAATTTATAAAAAATCAACACATTTTTCAAAAGTGTGAGCGTGGCACACTTTGTGGGTGTTAGAGTGGAGGTGGCAACATGGGTAA
 

Search Again