CR01352

CRIMIC CR01352

Gene CG33680

CG33680

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK83279

Images

Construct Sequences

sgRNA sequence
CGCTTTACTATCGATTCGATAGG

Amplicon 5' Amplicon 3'
AATGGTAATCTGGGCGGGTGTGTAATCGGACTGACAAACGTCTTTCCAGGAGGGAACATCTCATCGAATGTGGCACTGGCAAGGATTTTATCTGCCACATCTAAAAAATGTTTAGAAAGACCGTGCTCCAGGCTTGGCGCAATGTCTTTCAGATATAATTCTTGATTGTTGTTAATAAGACTATTTCCTACGTCTCCCAAAAATCTATCGCCGCTAAACAGGTTTGCCAGCTTTAATTTAAAATCCTTAAAATCAATCAGTGTGGTCATCTTGCTGAATTTCACATAGTCTTTGCCATTTCGAAGATACCGAGACCCACGAATTTTAACGAATGCTTTTGCGTTTTCTGATATAAATCAAATGAGTTGTGTTTTAGTTTTTATGTTAAGTTAAAACCTACCGCAATATCCCTGCATGTTTCCCTTTCCTTTTATGTCTGGGAGTAGCAAATTCAGATGCAGCGAGTACTTCCCTGTATAGTCTAAGCTACATTTTAACAATGATTATACTCAAGTACATAAGACGTTCAATGACAAAGTTGCTCCCTCCGTTGGCTTCAAGATCTTTGAAAACAGCTTGAAATTGGCTGCTTAGTTTCAGTTCAATATTATCTAAGGACAACGGTTCTAATGGGGATGTTGGGAATCCATCCCCCAAGTTGCCATGCACTAGTAAAGGCCTTATTTGATACGCAGCGTTTATAATACAGCGCTCCAAAAGAGGTTCATTGCGGGCGCATGGTGTTATTGTGAACGCTAACAGAAAAATATTTATAGGGAATAAAAAATTACTATTTGAGGTGCAATGCAATTAGAGACGTTATTAAAAACCGTTACAAAATAATCCCTTGCACTTGGTGCAATTGGATACTTACGCAGCTTTGCAATAATTAAAGGACACTGCAACAATAGCCACACCAGCAATAATACGAAGCTCTCAAAACACCTATAGTAAATAATTTCTAGAGCGGTTTTATACAATGTTTTTGATTTGAATGAACTGTAGTTGTTGCAGACAAGCGCTT AGGCAGTAGATCGTGCTTTTGATTGAATTAAGCGTGGTTAGCTAAAGTCTCTCCCTCTCTCGCAACATTTTCGTAGCAATAAACGAGCAGCTTACACTTACAAATTCACAAGACAACGATAACGCAGTTGCCCACTGACGCCACTCGGGGGCACGTGAGTTGTCGCATTGCACGTTAAGTTAAATTTATGTGGTTTAAAGTGAATTAAAACAATGCCGAATTCACGGCTTTAACATTGAATAACAAATGCAACCAAATCAGCTACGAAAATTTAAATAATAAATTTATCTGCATTCTCCAAGGGCCAACATCGTCGCAACAGTTATAATGTATGCGTAAGGATAAGACAAAACTAGATTGGGGATAACATCAACACCAATCAGGAAACACAAAATGTTTATTTTTTTGCAATGCAAATTTGAGATTTATTAACGAAGCAAGCTAAACATAAAATAAACATTATACTTTGGTCACCATTTTACCAGCAACTTATTGTAAAATATGTAACCATCGCGAATGCTGTCACCAAAAGTAATCATTAAAATTTTATAGACTGTATAAATTGAAATTTAAGATAAATTTAAATTATTTAAAAAATCTATATATAACAAGAGATTCCAGTTCCCTGACTATCATATACCCGTTAATCAGCTAGTGGTAGTGCCAAGGAGAAATTTTCACAGTTTTCTGGCATCACGATAGAAATTATAAATAAATACTAAGACAAAAAAAATTTAATATTTCAAAGGTTTGTGAGCTTTGAAAAAGGTTCTTTGGCCTCGATAGATATTTACAAAATTTATAAAAAATCAACACATTTTTCAAAAGTGTGAGCGTGGCACACTTTGTGGGTGTTAGAGTGGAGGTGGCAACATGGGTAA


Search Again