CR01350

CRIMIC CR01350

Gene Myo31DF

CG7438

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK83278

Images

Construct Sequences

sgRNA sequence
GGTTAATTTACACTCGCTGATGG

Amplicon 5' Amplicon 3'
AGAGCTCCCGACCCTTGTATTTGCGAATGGTTTCCGGACCGTAGATGTTCATCTGTCTGTAGGGATTCATCGAGACGCACACTTCGCCGATGTATGTGTAGATGGATCCGTTTTGGAATCTAGAGAAAGAGTAATGGACAGTCGTTCATTAGTTCGGCAGTGTTCGCTGCAGTGTTTGGAATGGCATTTCCCCAAGCTTACGAAATACATTTCGAGTGAGTGGGAGTGACAGGTGGGGAGCCACCACCCGTCGTTGGCGCCTGTAGCTTTCAATTCGAAAATTGCTTTTTCAACATTCTACATGCGGGTCTATATACCTGATATACCTGCTCCACATGAAGCCAACGATCGATATAATTGAGCGAGATGCGCTATGTAGATCAAATTGTTGATCTCTTTTCTCACTTTTTGATTGACTGACATGTGGATGCATTTATTCTGCACTCGATTTGTCAGGCGCCAAAAGATTGGGCATATAAAAGTTTGTTGTGTTCATAAAATGCATTCGCTAAGTGGGTCACTTGCGATCGATAGACAATGAGAAAGAAAGAGAGCATGAGAATCTCAAATATTTCACTTGGAGACTACAATATAAAGTATATATTATTCTGAACTAAAACTTTAGTTGATAAGAGTTCTAATAAGTCTTTTTCATGACACAGGCTATCTTATCTGAAGCGATTGCGAGTTCTTGAAACTATCGACTGGATTATTATAAGTTGGAAACTAAGATTTTGCAAAAGATACTTTTTTATTGAACTTTGCCTCTTCACAAGTATTTAGATTAAAAGTGAGTTGAATTTACACATGATAGAGTGATTTTCTAGTTTGCCTTAAGAACAGTTTAGATTTCACTGCATGTGAGTGGAATTGAAAAACAATAAAGCAACTTAAATGCAAATTACGCATTACGTGTTCCCAGAAAATTACCCAGAGTGTTCCGAAAGT AACCCAGATGAGCTACATAACCAAAAGTCCAGCCCCAAAAAGAAAAAAAAAACAAAACTGTGCAACAAGTGGCTATTACAAAAGGCTGGACAGAGTGTTATTTTCCCTCCCAAAACCAGAAAAACAAAAAGCCAAAAATGTAAATGAAAATGAAGCCAACAAATTAGCAGACAAAGAAACGGTAAAATTGTTTAAAGCCAGAGACCAATTCGAAAACTAAGCCCAAACCAAACAGCCAAAAGTTTTCGTTAGCCCGAATTGAGGGAATGAAAACGATTAAAACAATACACTTAATACGCGCATTTGTTTGTATTTATGTTTTGGCTGCTGGTTTGGTGCCCATTTTTTCTTCGAACACATGTTTTTACTTAACTTTTCAGTGCTTATTTATAGAGACGACTGCGCTGGCTTTTCAGCTTTCTGTTTCGTTTTGTATGCCTTTGGCTGCCCCGGCACTTCTATTTGCCTTCTGTTGCCCTTTTCAACACATTAAGAATTTTGCGTCAAAACGAGTGCGACGAGTGACAAATGGCCACCTGAACTCCGGCTCCAGAATGGCCAAGAAAGTCCAAGACGCCGTTTAGCGCGCTTTTCAACTTCTTTTTTGGGGCCATCACATTATGGTAAGTACATACATATAAGTTGAACTCAGTGGCAAAAGGGCAGGCAGCAAATGACAAGCCTCTTAGAGGCAAAGGAAACCCAATACGCCACAGATTTGTATGATTTCTACCCCATCCTCCCTTTTACAACAACCATATTGACACCATGTGCGCGCCACTGCGAAGGGTCTGTCCTTGTGTGTGTGTGTGTGTGTGGGTGGGTGGTGATCGCCCACGGGGCGTATGATTGACATCATGTCAAAATTTGTTTTTGGCCCGCATGACGAACAGCACACTCG


Search Again