CR01349

CRIMIC CR01349

Gene CG9331

CG9331

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AAGTGCAAGCGACAGACGAGCGG

Amplicon 5' Amplicon 3'
GCAAACCAGTTGTGCGTCTTATACATACGCCGTAGGAGAGACTGAGACTCACATCAGCTGCTCGGCGGCTTGAACGCCTACAGACATACATACATACGTACATACATATATAGGGAGAGATTTAGAGCGCGGATTATAATGCTAAACAGGTTCATTGGTTTATCGGCTGCGATCGTGGGTCGGAGCAGTCGGATCAGCGGCTTTCCGTTCTCGCCGCTCCTTAAAGCTGGGTGCGTATGCCGCTTGAGAGTTCAGTCGCTCGCGAAACACGACTTCGATCGCAATACTTCGAGATGAGATCGATTGCCACCAACTCCCTGCTGCCACTGATTGTGGCCTTGCTGATCGCCGGTAGTAATGCCTCCCTCCCACGCAGGGGCAGCAGAAATCAAAGCCAGAATCGCACCATGTCCGCTGGCAAGGCTTTCAAGGTCCTGGTGACACATCCCGAGGTTCCCCAGGAGGGCATTGATCTGCTGAAGGAGAACTGCGAGATCGTCCAGGTGCAGAGTGTTCCCATCAACCGGGCGGAGCTGCTGGAGAAAATCCGTGGCGTGGATGGCGTTCTCTGGGGTGGACACGAACCCCTCAATGCCGAGGCCCTCGATGCTGCCGGTCCCCAGCTGAAATCCATCTCCACCATGTCGGCGGGAATCGACTACGTCGATGTGCCGGAGGTAAAGAGACGTAAGATCCCGCTGGGACACACGCCCACCGTTCTCAACACCGCCGTGGCCGATTTGGCAGTGGGTCTCCTGATCGCCGCCAGTCGCCGTTTTCACGAGGGTCGCAAGACCATCGACAAGTGAGTACCACTAGTTGGTTAGTTGTGTTTGTGATGATTCATATACTTACAGAATTAATTTGAGCAATGACAAAAATAGAGTAAACCGAAATTATAATTGTCATAATTATTATTATAATTAAGCTAAACTAGGGACACTTTATTTTCAACTTAGTGTGGCCGTGAAATGTATACGCATGAATTCTCGATTAAAATTGCAAGCCGGTTCTTAAGAATACCGCCTGTCCGC GTCTGTCGCTTGCACTTTTGCTCTATAGCGCTCACAAGTGGACAAAGCATTATCATCAATAGGTTTTGGCTCCTCACATGCATAATGTAAAATTCTAAAGTATTGACTTTCGATTTATCTACAAACAAAAGGTACGAGCAGTTTATGTAACCGCCGCTAGGTGGCGGTGCAATAAAAAAAAGTTTTTTTTATCTTCATCTTAGCTTAGTAACAGGCATTTATCAGTATCTCGAGTATCTACAAGTATATTATATATTTTGGAAATATTCATATATCTTTCAATTTCTTAATTTGTATCTTTTGCGTTCTAAAAGTGACAAGTGGGAAAACTACCATCTTAACTGGCTGTTGGGCCAGGATATTCGTGATTCCACCGTGGGATTCTACGGCTTTGGAGGCATTGGTCAGGCTATTGCCAAGCGTTTGTCTGGATTCGACATTGACAAGGTGCTGTACACCACCCGTCGTCGTGTTCACAAGGAGATCGAGGAGGAGTTCAATGCCAAGAAAGTTGACTTCGATACCCTTCTGGCCGAGAGTGACTTCGTAGTGATCGCTTCTCCTTTGACGAAGGACACACAGGGCGTCTTTAATGCCACCGCCTTCAACAAGATGAAGCAGACTGCTGTGCTGGTTAACATTGCCAGGGGCAGTAAGTTACCAGTATTAATTGGGATTCTCGACCGATTTTAACTATTTATTTTATTCCTCAGAAATCGTCAACCAGGATGACCTCTACGAGGCTTTGAAAGCCAACCGAATCTTTTCCGCCGGACTCGACGTCACGGATCCGGAACCATTGTCGCCCAAGGACAAGCTGCTGACGCTTGACAATGTTGGTGAGTGGGAAAATGAAAATAATGTTGTAGTTTATTGATATCAGTCCTCAGGCCCACACCTAGCAAATACTCGTATTTCTGGCCCCTTATCAATATAAAGATTTTGACTTATCTCTTCAGTGGTTGACAATGACTAAAAGTATTTTGAAATTAATGGAATCTTTAAGGTTTCTTGAAGGTTACAAATAAATAGGGTAACGTTTATTCTTTCCATGTTTTATCTAATTTCTGCGTCCTTGTTGACCTC


Search Again