CR01349

CRIMIC CR01349

Gene CG9331

CG9331

Information

Donor Location Cytology FBti Stock number
pM37-p22L:20826316..2082631938F1FBti020690583277

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence AAGTGCAAGCGACAGACGAGCGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GCAAACCAGTTGTGCGTCTT GCGGACAGGCGGTATTCTT GTCTGTCGCTTGCACTTTTG GAGGTCAACAAGGACGCAGA
 
Amplicon 5' Amplicon 3'
GCAAACCAGTTGTGCGTCTTATACATACGCCGTAGGAGAGACTGAGACTCACATCAGCTGCTCGGCGGCTTGAACGCCTACAGACATACATACATACGTACATACATATATAGGGAGAGATTTAGAGCGCGGATTATAATGCTAAACAGGTTCATTGGTTTATCGGCTGCGATCGTGGGTCGGAGCAGTCGGATCAGCGGCTTTCCGTTCTCGCCGCTCCTTAAAGCTGGGTGCGTATGCCGCTTGAGAGTTCAGTCGCTCGCGAAACACGACTTCGATCGCAATACTTCGAGATGAGATCGATTGCCACCAACTCCCTGCTGCCACTGATTGTGGCCTTGCTGATCGCCGGTAGTAATGCCTCCCTCCCACGCAGGGGCAGCAGAAATCAAAGCCAGAATCGCACCATGTCCGCTGGCAAGGCTTTCAAGGTCCTGGTGACACATCCCGAGGTTCCCCAGGAGGGCATTGATCTGCTGAAGGAGAACTGCGAGATCGTCCAGGTGCAGAGTGTTCCCATCAACCGGGCGGAGCTGCTGGAGAAAATCCGTGGCGTGGATGGCGTTCTCTGGGGTGGACACGAACCCCTCAATGCCGAGGCCCTCGATGCTGCCGGTCCCCAGCTGAAATCCATCTCCACCATGTCGGCGGGAATCGACTACGTCGATGTGCCGGAGGTAAAGAGACGTAAGATCCCGCTGGGACACACGCCCACCGTTCTCAACACCGCCGTGGCCGATTTGGCAGTGGGTCTCCTGATCGCCGCCAGTCGCCGTTTTCACGAGGGTCGCAAGACCATCGACAAGTGAGTACCACTAGTTGGTTAGTTGTGTTTGTGATGATTCATATACTTACAGAATTAATTTGAGCAATGACAAAAATAGAGTAAACCGAAATTATAATTGTCATAATTATTATTATAATTAAGCTAAACTAGGGACACTTTATTTTCAACTTAGTGTGGCCGTGAAATGTATACGCATGAATTCTCGATTAAAATTGCAAGCCGGTTCTTAAGAATACCGCCTGTCCGC GTCTGTCGCTTGCACTTTTGCTCTATAGCGCTCACAAGTGGACAAAGCATTATCATCAATAGGTTTTGGCTCCTCACATGCATAATGTAAAATTCTAAAGTATTGACTTTCGATTTATCTACAAACAAAAGGTACGAGCAGTTTATGTAACCGCCGCTAGGTGGCGGTGCAATAAAAAAAAGTTTTTTTTATCTTCATCTTAGCTTAGTAACAGGCATTTATCAGTATCTCGAGTATCTACAAGTATATTATATATTTTGGAAATATTCATATATCTTTCAATTTCTTAATTTGTATCTTTTGCGTTCTAAAAGTGACAAGTGGGAAAACTACCATCTTAACTGGCTGTTGGGCCAGGATATTCGTGATTCCACCGTGGGATTCTACGGCTTTGGAGGCATTGGTCAGGCTATTGCCAAGCGTTTGTCTGGATTCGACATTGACAAGGTGCTGTACACCACCCGTCGTCGTGTTCACAAGGAGATCGAGGAGGAGTTCAATGCCAAGAAAGTTGACTTCGATACCCTTCTGGCCGAGAGTGACTTCGTAGTGATCGCTTCTCCTTTGACGAAGGACACACAGGGCGTCTTTAATGCCACCGCCTTCAACAAGATGAAGCAGACTGCTGTGCTGGTTAACATTGCCAGGGGCAGTAAGTTACCAGTATTAATTGGGATTCTCGACCGATTTTAACTATTTATTTTATTCCTCAGAAATCGTCAACCAGGATGACCTCTACGAGGCTTTGAAAGCCAACCGAATCTTTTCCGCCGGACTCGACGTCACGGATCCGGAACCATTGTCGCCCAAGGACAAGCTGCTGACGCTTGACAATGTTGGTGAGTGGGAAAATGAAAATAATGTTGTAGTTTATTGATATCAGTCCTCAGGCCCACACCTAGCAAATACTCGTATTTCTGGCCCCTTATCAATATAAAGATTTTGACTTATCTCTTCAGTGGTTGACAATGACTAAAAGTATTTTGAAATTAATGGAATCTTTAAGGTTTCTTGAAGGTTACAAATAAATAGGGTAACGTTTATTCTTTCCATGTTTTATCTAATTTCTGCGTCCTTGTTGACCTC
 

Search Again