CR01348

CRIMIC CR01348

Gene CG10383

CG10383

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGTAAAAGTTGTGAGTCATCGGG

Amplicon 5' Amplicon 3'
ACGTCACCTCCGATTGCAAAAACAACTACCTAATTATCCCATTCTTCGTATTTGAAAACACGCGCCAAGTGCAAAATTACAAAACAAACAATAAGAATAGCACTATTATCACTTCTGATAAGCAGAACTATAAATTCGCGGGGGGCACTAATATTAAAAACTGCGCATTTCAATGGCGCCAAGCAAGTTTTGGTATCTGTTTTTTTTCAGTGTTTCCTTTTTTTGTGGGGGCCTTGAACAGCTGCGAACGCACACGCTGAAGAAGAAGAAGTAGAGGCGAGCCAAAAACAATAACAAACTTCACCAGCTTGCTATCTCACTTTTACAAAATCGTATGTTATGTTTTGATCGTGTTTCGTCGAGAAAAAAAAGAGTCTGTATAATGAACAGCATGATTATGACCACGAAAATACCCTTTGAAACTTAAAAATACTCTTTATGAAAATAGGTTTTGTCAGCTCTAACTGGTCTTGAATCTAGTAAAATGTCTGATAAATGATGGTTATTTGCTATAGTGAAATGAGATCAATTTATTACTGTAATTTTAAGATCAAGTGCAATTCTAAATCAAAATCCTATCAACATATTATCAACATCCATTTTAAGTCACCCCACCGAAAACCCTTTTGCTTGAAACCAATTTTCCGCTAATGCCTGATTATTAACCGCGCCATTTGTTGTAAACAAATGACGTCACAGCTGCGACAACACCCATTTAGTATAGGGAATGCGGAAAACAAGATCTGTTTTTGTTGTTGTTTACTCGATATATGCATATAGTATGCACAGATCGTACGACTGATCGGTGCAATGTGGCGCCATGTAAAATGGGGCAAAAATAAAATGAAAACGTGTGCAGACGAGCCCCCTAAATCGTAGTAAGCC AATTCACCGCACACAAGGAAAATTTTTTATACGAAATTATAGTCTTTTTAGTAGGTAAATTTTATAAGATTTGTACATTGATTAGTTAAAAACACTAGTCCATACTTTGCTCGCGAATTATTACATTTTTAAATCAAAAATGGAAGAGCATGTAATAAAAGGGAGCTACTTTTTATTTTCTGTGTACTGCGACCTGTAGCAGCTGCTTGGGAAATGGGTTTGTTGTGGTTTTCTCGGTTGACATGGCGTGAATTACTTACGCAGTAATAAGGCCAACTCCTCCAAGGCCCAATAACTTCGGATGACGGCGCAGCTTGATCTTGAGATCCTCCAATGACATTGCCTGCTTTCTGATGGTTTTGTTTCAAGTGTTTCTTTGTTTTTCAGTGTAGCACTAGGCACACACACTAACGGGATTCACTCTGCAGTCGACTGCCAAAAGTTTGCTCAGTTTTTCACACTTTAAATTTAGACGATTGTATCACACACACTGGCCCATGCAAATGATAGCACTAGGGACTGTTTAGACTTTGTAGCTGTCACTGGGACTGCTTATAGTTTGTTTTGTTGCTTGCTTTTGCTTGTCTGTTGAGCTCTTATTGCTGGCGAATTTATCAGGACTTTCGTTTTTATAAACTAGCCGTTGGTGTGACCGTGCGCGCCTGTCAGCTGTTGCCATTCGCAGCGAGACCATTCAGCTGACGGAAAACAGATGTGGGTGGTGTAAAGCCCATGGGCAGGTGTTGGTGACGTTTCTGGGGGGTCGAGTTAGAACGAATTATTTTCACTAGAATATTTTCATTTTTCTAAACTGCTTAAATAAACTGTCCATTTCACGCAACGCTGACAAACTGTAATTTTGCAGCGTTTAAATCAAATATTTAGTATGACCGAATCCGGCTTGATGCAAATAATTCACCACCTCCAGCATTCACCGCGAAACGCACCCACTGCACAGCTGACTGATAACACAATCGGAAGGGGAGAACTTCATTTTGGGGTATATTTATTTTGGGCCACAATTAGTTGCTAGCATTTGATTGAAGTAGCTCCAGCTCCATTGGCTTGTTTGTAAAATGCCCTAGAGTTCGCTTTCCAACGCCGCGTTCATTGATTCGTT


Search Again