CR01341

CRIMIC CR01341

Gene OstDelta

CG6370

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK83273

Images

Construct Sequences

sgRNA sequence
GAGAGCTACGACTTTGCAGCCGG

Amplicon 5' Amplicon 3'
CTGGTCAGCAGTAATGGGCACGGGCTTGTTAAAGGTCTTGCTCACACCGAAAGCACCATTGATGATCAGGGATGTGATACTGAGACCGCCTTCGAATTGCAAGAGCTTGCCGTCAACTTCATCTGCTTGCACGATGGCATCCTCCACGCGATTTGCGATAAAGGAGGCACTGGCACCCAGAAGTGGAGCAACATTGAAAGCGTATCCCAGGCCGCTGAGTGTGTCGTCCTTCTTGAGCAGTTCTTGCAAACGCTTCACTAGTTTTTCCTGAGTGGCTTCATTGATCTCCACGCCGAGCACTTTGTGGGTGACCACGCGGTAGAAGATCTCCTGAGAGCTGCCGAGCTCCGAGTTCAGGGAACTATACACCTTGGAAAGCAGACCCTCGTCAATCTTAGCGGAGCAACCCAGGTTTCTGCTAGCACCAATGTAGTAGTAGTCTTTTTCGAAGCTCTGCAAGGAGTTAAAGGAGCATAAATAAGTATGACTATTGATAAATGGGCATATTTAGATAAACTCACGTTCAGCTTGGATTCGGAATGCAGCGTAGCAATCTTCTTGCACAACGGCTCCTTCTGAGTGGCATCAGTCAGTTGAATGTTTAGGCTGGAGAAGAAGATCGACTGCAGGTCACTGGAACCAAATCCGTCCACGAAAACTTTTTGCAGGCGGCTGAGATCCTTTTGCCCCAGGTGACTGTCCACGGTGCGGGCGCTCCACGTCGGCCCACTAGCGACCAACACGCAGAAGATGACCAGACCTGGCGTTGAATAAAAAAAAAAACCATTAGGTTCCAAGTCGCCGGCAATCGCTTAACCACGAAAATCAGAGAGAGACAGCACGAGAGCTACGACTT CCGGCGTTTCCACTGAATTTAGCGTCAAATTAAAGTTCTCCGGCTCAAACACCGAGCAGGCTACGCACCTAGCTTTAACATTTTCCTATATTGTGGTTGCGCTTTCACACGCCGCTTATATTCTATAGGAAAATAAAATTAAATCGCTCAAAAATCACCGCCTGTCCCTCGATATTTTATACACGTCAGCGGCCGAGACAACTATCGATATGTTTCTGGATCAACAAACATCGATGCGTAAACGAAGAACCATCGATGCCCGCTGCAAGAGTGACCGTATGCATGCTCTACTGTAAACTCAACCGTTATAAAACATTACGTTTAGATTGAATTTAAATAAAATGTTAATTTAAACTAATTGCATAGAATTTCTCAAACTGCAAGTTTAATTTTTATGTAACATTTACAATGAAAGATCAAAATTAAATAATATTCTGTGGGCACTACTCTCATACAATTTCCACATCTAAAGTGCAAACTTATCAGGACACAGATCTATAGGTCTGGTAATAGAATATTTTCTTTTGAAAGTCTTGGTGAAATCTCCCTCGTGATTCCATACTGTTACGGCAGTAGTGCAGTAAAGTGGATACTTGTTGACCAGAACTTCCTCGGTCTCTTCGTTTTTCGGTGGCACATCCTTGCAGAACTGGTCGTAGTACTCCGTGCGATCCTCACCCAAATCCACTTGGGCGGAGGCCTGTCGGTTGTATTCGGCAAAGAGTTCCTGCCATAGAAACTGTTCCATGCGATTTGCTCTAGTGGCTGCATGACCATTCGGATTAGAAAAGTTCTAGAATACTGCAGTCTTAACTTACGGAGCACTTTCTTAATTTTGGGTGGAGCAAAACTCGCTTG


Search Again