CR01340

CRIMIC CR01340

Gene CG8046

CG8046

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK83272

Images

Construct Sequences

sgRNA sequence
TAAAATCGAGGTGATCATACGGG

Amplicon 5' Amplicon 3'
GTGCCAAACCGTGCTGAAATATTTGGTATGGAACACATTAGAAATTTATCGCACTCGAGGTTCATAGAAACTTACCCCAGCAGAATAATACCGATGCCAAATAAGAAGGCGCTAAACACGTTGAAAATCCCCGGTTCAGTGTTCAGTGTACGGGTGTAGATCGCAACGTACAAGGTGGAAGATATGAGGGGGGAAAGTGCTTGCAAGACACCAAGCAGGGCAAAGATTTTGCCTAGAAAGGGGAAACCACAAATATGTGTGTTAAGAACATGATCATAAGGCATGCCATCCGTACTTACCGCGCTCATCAGCCGGCAGCAAATTGGTGATCATGGTGCGGCACATGGGGTTCACAAGCGACTTGAAAACGCCCAGCCCAATAGCCACGTATATCTGCCAGCTCTCCAAGGCGAAGCCCTTCATCAGGCTGCTGGAGCAGTGGCTCAGCAGGGAAACCAGTGCCAGCCACAGAATCGCCGAATTGGTGCACTGTCAGTCAAAGGGGTCATGGGTCATAGGTCAAGCACCAATTTAGCTAGCTATCACATACAACTCACCTTGCGGAGCGACCAAATAAAGAGAACTCCACCTGAACCAGCCACTGCGGGTACAAGAATGCCAACGGTCTCGTACTCAGTAAACTGCTTTACGGTCCAATGGAACTTTATCCTCATAAACTTATAGAACACAGAGTTGCTGCCGTCTGGCGATAGCCAAAATGAATATATCAAACCAAGATCTTTGTCAATGCTTATCCACAAACAAAAGGACGTGTCAATTAATAACAAACCCATTTCAGAATTTCAATCGATTTATGAAATCTTGAAGTGCCAAAACGATTTAGGTTCATAAACGTTTTCAGGGCTTTCC TTAAACGACGCTTGCATGCTAAATTATGATTTTTGGAACTTACCCGATACAAAGGCGGTGAGGAGGAGTACTACCATGATGGTAGTGAGCATGAAGCGATTCTGGTGCTCACGAGGCTTCGAGCAGGTGCTCCACAAACTCTTCAGCATGGAAACCACACTGGTGTCAGTCGTCGGTGTTGATAGTGTCCTATTTCTGGCGGGCAAACTCTCCGGTAGTAGGAGTGCCATCAGAAATAGAGCCGTGAAAATGCAAACTGCAGATATGCTGAACACAATGTAGGCGTCCGTGGCCTCGTATGCATAACCAGAACCAAGGCTACCAAGGAGTAGGCCCACATATATGGCCAGTTCATAGGCAATCATCCTAGGGTGCATAAGTCCATAAGTAATAGTAAATCCACTCGATTCCTTGGCTAACTACCTGTAAGATCGAACTTTTCCGCCGGAGACATCGGCAATAAAACAGACGGCAGCCACGGAATAGGTCACACTGCTTCCCAAGCAAGAGAGCGGTACGATGGATAGCACATACCACCAGGGACTGACCAGACCTTGGGTGTACATGGCACAGTAGGCAATCGCAGCTGAAATGAGATACTGAAGGCCGTAGCCTGCATAACAGGTTAAGCACATGGGCATCTTCTGACCAGCGGTAGTTTACACCCACCTAGAAAAGAGCACATGAGAAGGGGCTTGCGTCCATAGTGGTCCGCCCAGGAGCCAGCAAAGAGCCCACAAAAAGCGGGAATAAAGCACTCCACCAATCGCATCGCCAGTGTGACCTGTGCAGCGTATGGCTGTACCTGCTCC


Search Again