CR01328

CRIMIC CR01328

Gene spz3

CG7104

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK83269

Images

Construct Sequences

sgRNA sequence
TGCTTGAGTCACTTATTCGTGGG

Amplicon 5' Amplicon 3'
TTCGGGAGATTGAAACGCGACTTCTTGCATAATAGCCCCGTAACCGAGTTGAGTACTTGAGGTCTCAAGTCTGGCAGGTTGCTGGCTGGCTAATGCCTCGACAACTCGCAGATTGAGATTCAGATTGAGATGGAGATGGAGAGGCAGAAACAAAGAGGCGCCACAAGCTAGACCGAAAGTGAAACATCCGAAAAAGTGAAGCGCCGCTGACAGTTTTCCAAGAGGACAACAAGGGCAGCAGATTCAGATACGAAGATACGTAGATACTTGAGCCGTTAGATAGACGGTCTTAGATACAGATACACCCCGGCACAACATAAATCGTGATGCGTGCCAGCCTGTTAGTTGCTATAAAATTCAAACACTGGCCATTACTGTCTTGAAAGTGACCTTGCCGATCGGTTTGTAGACCTTTGACCTTGTCGCCGCTCGTTGCTTGTGCGCTGTTTACCCCACAGGTTTGTTATTTGTTATAGTTGCTCGGCGATCTTGTGCAGAAGTTGCTCTCAATTGGAAAGATACACAAAAACAAGTAGCAGGCGAAACCACAGAAATTAACATGACTTTCAGCGCCCGTCTTTCGAATCGTGTGCAAACGTGGGACTCTATGCCGCTTATCTCTGTGAATCTACATACATGCTCTAAATTCACACTACACATATGACTTGACTAAAAGCAAACAATTTAAGCCACCAACATTTGGTTCGTTTTTAATTGTTAATTGTTAAGATTGCCATCTCCGTGAATCAGGAAACACTCGAACTGGAATGTACTCAGAAGAGTGATACGACAAAGTCCGGAGAATTTCTTTTGGATGAATGAGGAAGTGATTCTCGGCCTCTTCAACCAAAGTTCTACATAGATCATACTGTCACATTATTATGCACTTAAATACATTTAATTAACGTCTGCTTGAGTCAC CGTGGGGTAGTTAGGCATTCCAATTGGAAGTGTTTCTTGGTTAACAAGTTGGCATATAGAATTTTAAAAATAATGCACTCCTTAAGCTTAGAACTCAGCTTCCTGTGCTGTTATGCAAATTCATATAAATCCTTTCGATAAATTAATCATTTAATAGTATACTATTTTATTATAAATCTGACCTCGTTCTTTTAAATTCTAATTCCTTAGTTTGTTTCACCTTATAGTAAAATATCCAGTTGGGTACTCACCATTCTCTTGGCCTTCGTAGAACTGTCCTTCCTCCTCTCCGTCCTCCTCCTCATCCTCCTCACCCTCCTCCACGTCGTAGTCTAGAACGGCGTGTACCTGAGTCCTGGATCCCTGACCAGCCTGAACCCGTGTAAATCCTGGTGCTCGTTCCGGATAATTCTCCGGCGGGGCAACTCCGTATGTCTGAGCTGGTTGAGCCTCCGGCTTGGCCTGCCTGGACCTTTGGGGCGGTGGTGCAGGTGGTGGTTGCTGCTGTTGCGATGGCGGTGGTTGTTGCGGCTGCGGTGGCTGCTGCTGCTGCTGCCTGCTGCCAAAGCTGGTAATACTAAAGCTGCCGCTGTTCTTAGTAAAAGTGGCACTGGCACTGCCGTGTGCATTGAAATATTGCTTCTGTTGCGGTTGCTGCTGCTGCGGCGGCTGTGCTTGCTGTCCGGGATAACGGGAGTACGAACCCTCCGCCGGTCCCCGGCCACTCGCATGAGTCTGTGTCAGCTGGATGGAACTTTGGCCCGTGGTGCTGCTCGAACTTGATCTGGAACTGCTGCTCTGGAAGGACACGCTGTTCTC


Search Again