CR01324

CRIMIC CR01324

Gene GluRIIC

CG4226

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK83268

Images

Construct Sequences

sgRNA sequence
CCAACAGAGCGTATTCGTCATGG

Amplicon 5' Amplicon 3'
AAAGGAGATGGCTGGAAGGCCTTCGCTGTCGTCTGGTTGCCATGAAAAATTGACACCTCATCGCCTTTCAATGGAGCACCTGGAACCGGGAGCTCCGCTCGTGGGTGAAAGACTGCGGCTGATTGAACCGTGTCCGGCTTTAATGGTCTCTGCTCCACGGGGAGCCAATCGCTGATCCTTCGTCAGCTAAACAAAACTAAATTAAATATTGGAAATATTTGCTTAGAATCTTATATAGTACAGCATGTCAGCTGACAGAGCTTTCCCAGTCAGCTGATCTCCGATCTCCACTTGTCGCATTCGATCTCCAATGGCCCGAAGAGCTTTCCCAGTTGCCATGGAATCGCCAGCCCGTGTGCTCGCATGAAAAAAGAACTGTCCGGAAATAGCTCAGCCCGCTGGCCACAGATGTTCGGTGGGAATTCCAGAGAAGCAGGCATGTGGCAGCGCATACTTTTGCTCGGCTGCATGTGGAGTGCATTTTTCATGTGCCGCAGCCGGGGGCAACAAATCAACATTGGTGAGTTGTGGTTAGGAGTGGGAAAAAGCAGCTACCTACTTTTTTGTGCAACCCGCAGGCGCCTTCTTCTACGACGATGAGCTGGAGCTGGAGAAAGAGTTCATGACGGTGGTCAATGCCATCAATGGACCTGAATCGGAACAGACGATGCGTTTCTATCCGCTCATAAAGCGCCTGAAGCCCGAGGATGGGAGTGTCACAATGCAGGAACATGGTGAGTCCACCCATCCACGCACTCTATTCCAAATAACTCGAACATATTTTCGCTTTCAGCCTGCGATCTCATAGATAATGGTGTCGCGGCTATTTTCGGACCAAGTTCAAAGGCGGCGAGCGGTAAGAGAGTGCGGGAAAATCTTGTGTAGAACGCGAAAGCAAAATAGAACGCGAGGAAAATTGGGCACAAGAAAATCGACGAAAACTTTGACGGCATCTCCCAGATTTGT TCATCTGTTTAATGAGCAGACCTCTACTCTCTTTTTGCAGACATTGTGGCCTTGGTGTGCAATAGTACCGGCATTCCGCACATAGAGTTCGACATATCGGACGAGGGCATTCAGGCCGAGAAGCCCAACCACCAAATGACCCTTAACCTCTACCCGGCCCAGGCCATATTGTCCAAGGCCTACGCGGATATTGTACAAAACTTTGGGTGGCGCAAGTTCACCATTGTCTACGATGCGGACGATGGTGAGTAGGAGCATTCAAGAGAATTTGTTTATATCCAGGACGAACTTCCCACAGCCAGGGCAGCAGCTCGACTGCAGGATCTTCTGCAGCTGCGAGAGGTTCACAATGATGTGGTGCGGGTGCGAAAGTTCCACAAGGATGACGACTTCCGGGTCATGTGGAAGAGCATACGGGGCGAGCGGCGAGTGGTTTTGGACTGTGAGCCCAACATGCTGGTGGAGCTTCTGAATTCCTCCACTGAGTTCGGTCTGACTGGACAGTACAATGTGAGTAATCCATGGGATCCACTAAGAGAAACAGCTTTTATAAACTTTAAAACAGCATATATTCCTGACGAACCTGGAAACCTACACCGATCATCTGGAGGAACTAGCGGCGGATAACGAAACATTTGCCGTGAACATAACTGCTGCTCGTCTTTTGGTCAATCCCGATCCTCCGCCGGTAAATGAAGCAGACAAAGCCCTATTCCCTTGGGCACACTAACTCATTTTGGTTTCGCAGTACTCCCTACCTTACGGATATGTCACCCAAAGGGACAACATCGTTTACGAAAGCAGCGATCCGCCTCGCACCCTCATCCACGACTTGATACATGATGCACTGCAGCTTTTTGCGCAGTCCTGGCGCAATGCCAGCTTCTTCTACCCGGACAGGATGGTGGTGCCGCGAATAACCTGCGACTTTGCCGCATCCGGAGGTCGCACCTGGGCCATGGGGCGTTATCTGGCACGCCTCATGAAAGGGGTAAGAACTACTTTCCGCATAAACCGAGGAATCGAAACGTTAATCTGCGAGGTGTGTGTTGCAGACTTCCGGCGTGAACAACACGAACTTTCGGACAAGTATCCTGCAGTTCGACGAGGATGGACAGCGGATAACGT


Search Again