CR01323

CRIMIC CR01323

Gene snsl

CG2837

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK83267

Images

Construct Sequences

sgRNA sequence
CATGAGCTCCAACTTGTTGCCGG

Amplicon 5' Amplicon 3'
TTCATGGCACTGGTGGGATCTGTTGCCTGTGCATTCTGATAATTGCTTGAAGAACTTTCTTTCACTGGTTTCTTGGCCTGATCCTTTGATTTGGGCTTCTGCGGTTTCATGCCATTCGACCAGGCCTGCAGCCAGCTGGCCCCATTCCTCTCCGTGGACGTCATCAATCTCTCCGCCTCCTCCATCACCTGCTGGCGATAAAGTTGACGGGCCAGAGCCTTCTGATCGCTCTGGCTCACCTGGCGCTTGTTGAACGATTGATCATCCTGGTTGGGCTCGCCGATGGGACGCGTCTCCTTCTGGGGACCCAGTTCCACCATCACCTGAAAGTCCGCATGCTCGCCCAGGCGAAAGCCAAAGCCCAAACGGGAATCAGTTCCTGTTTCAATATAAAATCGCATTAAATTAATGGTTCCAATTGTATATACATCATCTTACCCTTTTTAATCGGTGGTATATTGGAGTAAACTATGGATAAGATGGAGGGCAGTTCCCGGGGCACAATAAAAGCTGATGCATTTTGTGCTGTAAAAGTATACAATAGTTAATTGACAGGGCCAGTCCAATGATTTTTATCTCTCTACTGCCGGCCAAGCCCCAGCACTTATGTAAATTTTTGGGACAGTTAATTTCAGGGCGGATTATGTAACCGTTTTATGGTCTTGGATTTTCGGATTCACGGATGACTAACAGTGCGTATGCTTAATATCTTACGGCTCTGAGGTCCGTTTCACTTTGAAGGTCGCTAACAAATTCTGAGTAATACTTTAAGTTGATACTATAATGCTAATAAAATAATTAAGAGTAATCTAAGACTAAGAATTCTCTTTAAACCAAAGCTGTGTTTAAGAGTATTTACTTTATTTACTTTATCCACTTAAAGTGCTTGATCTTATTATTTTATAATGATTTTTTCTCGTACCTAACTAGTTGCCCATTTCAATGGAAAAATACTTAATGATTTTACTCCTTGTACTTTGATCACAAAGAATCATTAGGTAACTCTAATCCGAACAGAAATAAAACCCAAAAAAAAAATCACACGAATCACATTGCGAGACAGACAATGAGACCCATAGACGATCCACAGGTTAAACAACATCTGCGGCTATCCGACGACCTTGACACAAA CATGTGTGAGAGCCCAGGGTGCCAAAGTCTGCCGTGGAGTCAACTGAAGATCTCGATAGACTGTCGCCGGATCGGTGGAAGTAGTTGAACCGGTTACAAATGCTCCAATCTGTGCGATTCGAACGATTTTAAAGGCATTTACTTACTGTGGAGCAGGCCGATCAGCACGGGCAGCCAGAGGCTAGCGAAGCCCCATTGTTTTGGCCAAGACATCATGGCCAGCAGCAGCAGTCAGCATTTATGTGGAGCCGCAGAAACTGCAATTACACACAGGCGATTACTTCATGCCACCAGCGATATGATTACTATATGTTGCAGAATTATGCCTTTGCCGCAAACTGGCTCGATTTTGGCGCGTTTGCGCAACAGTCAGAAAACCCGATCTCTGACTTGAGGTTGGTCAGGTTGACCGCTTGAAAAAACCAGGTGCGTCATTTGGATAAATATTTGAAATATTTGAGTTGCCAGGTTTTCGTTGGCCGCTTTTGTTTACGCGATTTCGATTCAAATGCGATATGCAAACACAAACACACACACACATACCATTTACTATACTATACTATGTTTTTTTTTTTTTTGGGTCTGTCTCGAAATAAAAGCGTAAATACAAAAATCCACAACGGCAACAACACAGCAACGCGGTTTGGAAATCACTCTCACTTTTGTTCAATGAGCTTCGCACTGTTGTTGGGTTTTTTTATGTTTTTATTTTTAAGGCTACCTTGTATTCGTTTGGTTGGGTTTTTTATTTATTTATTTATATTTGTTTTTCCTTTACAGTTTGGCCTTGTCTCATTTTGGCCCTGATTGATTTCTGACTTCTTTCGGCATTTTTTACTGCTGTAAATTCATTTACACGCTAACCTCCCCAAATTGCCGCTAATAAACTGGGCAAACATCGCGCAGAAATTTCGGATCGCATAAAAATGAAAGTTAGTGGTCATAGAAATGTGTCTTGCTATTTTCGGCAGTACATACTGCAATTTTTCTTTTTTTTTGGTCTCTCGGCAAAAACAAAACGTAACGCACATACGAATGGCATAATTATTAAACTAACGTATTTTCGGTTCAATTCAATTCGATTCGAATTACTTAGCGAGTGCCCACCGTATCTCCAGTA


Search Again